Incidental Mutation 'R4237:Vmn2r76'
ID321168
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 041054-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R4237 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86230532 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 187 (I187L)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: I187L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: I187L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
6820408C15Rik C T 2: 152,428,953 T32I possibly damaging Het
Abca13 A G 11: 9,434,188 K3880R probably benign Het
Ahnak C T 19: 9,001,783 L144F probably benign Het
Antxr2 A T 5: 97,938,407 I447N probably damaging Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Clip2 A G 5: 134,535,197 probably benign Het
Cntnap2 A T 6: 46,530,390 probably benign Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dicer1 A G 12: 104,729,228 V148A possibly damaging Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Galnt11 G A 5: 25,265,260 R569Q probably benign Het
Gpr6 T C 10: 41,070,608 N326S probably damaging Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
L3mbtl3 G A 10: 26,340,948 A181V unknown Het
Lrrc37a G A 11: 103,502,289 T770I probably damaging Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr2 T C 7: 107,001,329 N177S probably damaging Het
Olfr715 A G 7: 107,129,037 S119P probably damaging Het
Olfr850 C T 9: 19,477,597 V215I probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Ppp1r13b T C 12: 111,838,736 T181A probably benign Het
Prc1 G A 7: 80,311,216 probably benign Het
Proca1 A G 11: 78,204,926 N128S probably benign Het
Psmd8 G A 7: 29,177,121 P155L probably damaging Het
Rad54l A G 4: 116,099,449 V500A probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Serpinb10 C T 1: 107,538,449 T55M probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Tdrd9 C T 12: 112,067,625 R1334* probably null Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trim28 T A 7: 13,027,911 H268Q possibly damaging Het
Wdr95 A T 5: 149,563,337 R160* probably null Het
Wnt5a T C 14: 28,522,866 C357R probably damaging Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Zfp184 G A 13: 21,958,778 R218H probably damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACCCAGATTCTTCGAATGTC -3'
(R):5'- CACCTTCCAAAATTTCTGGATCTTG -3'

Sequencing Primer
(F):5'- TTCGAATGTCTAAAAACTGCCACAG -3'
(R):5'- CTGGATCTTGTTAAATAGACCTACG -3'
Posted On2015-06-12