Incidental Mutation 'R4237:Tdrd9'
ID321187
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission 041054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4237 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 112067625 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1334 (R1334*)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably null
Transcript: ENSMUST00000079009
AA Change: R1334*
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: R1334*

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193630
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
6820408C15Rik C T 2: 152,428,953 T32I possibly damaging Het
Abca13 A G 11: 9,434,188 K3880R probably benign Het
Ahnak C T 19: 9,001,783 L144F probably benign Het
Antxr2 A T 5: 97,938,407 I447N probably damaging Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Clip2 A G 5: 134,535,197 probably benign Het
Cntnap2 A T 6: 46,530,390 probably benign Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dicer1 A G 12: 104,729,228 V148A possibly damaging Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Galnt11 G A 5: 25,265,260 R569Q probably benign Het
Gpr6 T C 10: 41,070,608 N326S probably damaging Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
L3mbtl3 G A 10: 26,340,948 A181V unknown Het
Lrrc37a G A 11: 103,502,289 T770I probably damaging Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr2 T C 7: 107,001,329 N177S probably damaging Het
Olfr715 A G 7: 107,129,037 S119P probably damaging Het
Olfr850 C T 9: 19,477,597 V215I probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Ppp1r13b T C 12: 111,838,736 T181A probably benign Het
Prc1 G A 7: 80,311,216 probably benign Het
Proca1 A G 11: 78,204,926 N128S probably benign Het
Psmd8 G A 7: 29,177,121 P155L probably damaging Het
Rad54l A G 4: 116,099,449 V500A probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Serpinb10 C T 1: 107,538,449 T55M probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trim28 T A 7: 13,027,911 H268Q possibly damaging Het
Vmn2r76 T A 7: 86,230,532 I187L probably benign Het
Wdr95 A T 5: 149,563,337 R160* probably null Het
Wnt5a T C 14: 28,522,866 C357R probably damaging Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Zfp184 G A 13: 21,958,778 R218H probably damaging Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 synonymous probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AATCTCCCTAAAATCTGCAATGTTC -3'
(R):5'- TACTCTGCCTGGAGAGCCTG -3'

Sequencing Primer
(F):5'- TCCTCAGCTTAGGAGACTGAG -3'
(R):5'- AGAGCCTGCTCCTGTCAC -3'
Posted On2015-06-12