Incidental Mutation 'R0398:Samd9l'
ID32121
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission 038603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0398 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3374502 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 920 (N920Y)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect probably damaging
Transcript: ENSMUST00000120087
AA Change: N920Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: N920Y

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 83.2%
Validation Efficiency 100% (81/81)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,445,367 R724G probably benign Het
Abcb11 T C 2: 69,286,666 Q546R probably null Het
Acr T G 15: 89,573,941 V275G probably damaging Het
Adam5 A G 8: 24,813,432 Y160H probably benign Het
Adcy5 T A 16: 35,269,068 M545K probably damaging Het
Aoc2 A G 11: 101,325,553 E154G possibly damaging Het
Atg2a T G 19: 6,246,578 L338R probably damaging Het
Atp2a1 T C 7: 126,450,418 probably benign Het
Bbs7 A G 3: 36,590,717 S436P probably benign Het
Bpnt1 T C 1: 185,338,158 Y16H probably benign Het
Cbll1 A T 12: 31,492,092 F90Y probably damaging Het
Cbs G T 17: 31,617,242 Q411K probably benign Het
Cdca2 A C 14: 67,697,962 F435V probably damaging Het
Cdh13 T G 8: 119,314,047 S664A probably damaging Het
Cdk17 T A 10: 93,237,840 V438E probably benign Het
Cep295 T C 9: 15,354,736 D40G possibly damaging Het
Col6a1 T C 10: 76,710,118 H840R unknown Het
Cpa1 A G 6: 30,645,251 T409A probably benign Het
Crlf1 G A 8: 70,499,089 probably benign Het
E2f2 T A 4: 136,180,544 I184N probably damaging Het
Ehbp1 T C 11: 22,095,886 D596G probably damaging Het
Ets2 A G 16: 95,716,223 Y333C probably damaging Het
Fam178b A G 1: 36,632,406 probably benign Het
Fndc3b A G 3: 27,461,779 V626A probably benign Het
Gart G T 16: 91,639,449 A140E probably damaging Het
Gbp7 T C 3: 142,545,513 S477P possibly damaging Het
Gm16380 T C 9: 53,884,169 noncoding transcript Het
Hmcn1 C A 1: 150,798,814 R579M possibly damaging Het
Hoxb8 A C 11: 96,283,111 H50P probably damaging Het
Hspa4 C T 11: 53,272,879 probably null Het
Hspa4l G A 3: 40,756,997 probably benign Het
Hyal4 A T 6: 24,756,671 Y296F probably damaging Het
Igsf8 C A 1: 172,317,499 T131K probably damaging Het
Ilvbl C T 10: 78,579,539 P298L probably damaging Het
Jak2 T A 19: 29,282,388 I229N possibly damaging Het
Kif1b T C 4: 149,204,231 D1205G possibly damaging Het
Lrrc63 T C 14: 75,126,470 R74G probably benign Het
Lvrn A G 18: 46,880,693 T481A probably benign Het
Macf1 T A 4: 123,351,017 T7312S probably damaging Het
Magel2 C T 7: 62,380,551 Q1068* probably null Het
Mrpl3 A G 9: 105,064,103 Y203C probably damaging Het
Nek2 T A 1: 191,827,361 I326N probably benign Het
Nlrc4 A C 17: 74,445,920 N489K probably damaging Het
Nlrp4f A T 13: 65,194,918 S304R possibly damaging Het
Ogfr C G 2: 180,593,699 R189G probably damaging Het
Olfr1151 A T 2: 87,858,057 N294I probably damaging Het
Olfr506 T A 7: 108,612,955 I216N probably benign Het
Olfr548-ps1 T A 7: 102,542,692 L252H probably damaging Het
Orm3 A G 4: 63,357,648 S145G probably benign Het
Pclo A G 5: 14,681,702 E3406G unknown Het
Pcx T G 19: 4,601,610 F4C probably benign Het
Pgd C A 4: 149,153,882 G364V probably damaging Het
Pla2g12a C A 3: 129,890,396 D102E probably benign Het
Pnpo A T 11: 96,942,427 C82* probably null Het
Prdm1 T C 10: 44,439,809 N792S probably damaging Het
Prim2 A T 1: 33,484,676 probably benign Het
Proca1 C A 11: 78,205,268 P242Q probably benign Het
Psmc5 A G 11: 106,261,544 N129S probably benign Het
Ptchd4 A G 17: 42,377,259 T231A possibly damaging Het
Qrfpr C T 3: 36,181,052 probably benign Het
Rab44 G A 17: 29,145,370 probably benign Het
Racgap1 T C 15: 99,628,627 probably benign Het
Rapgef4 A G 2: 72,031,041 E25G probably damaging Het
Rpl8 G C 15: 76,905,046 probably benign Het
Samd12 G A 15: 53,719,720 P73S possibly damaging Het
Sdk1 T C 5: 141,962,721 V607A probably benign Het
Slc25a19 A G 11: 115,617,575 Y196H probably damaging Het
Slc39a3 A T 10: 81,033,787 M12K possibly damaging Het
Slc5a4a T C 10: 76,182,722 I501T possibly damaging Het
Sp4 A T 12: 118,298,673 V546D possibly damaging Het
Ssh3 C T 19: 4,263,699 V511M possibly damaging Het
Stard9 T G 2: 120,696,307 V1015G probably benign Het
Thoc5 G T 11: 4,921,978 V516F possibly damaging Het
Ttc21a T A 9: 119,954,562 I570N probably damaging Het
Ttc4 T C 4: 106,667,573 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Yipf3 A G 17: 46,251,485 E298G possibly damaging Het
Zbtb34 C A 2: 33,411,048 E494* probably null Het
Zfhx3 A G 8: 108,951,246 Y2976C probably damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCACTTCCTGCGATCAAGACC -3'
(R):5'- AAGAGCCTTTGAGGCCAAACTACAG -3'

Sequencing Primer
(F):5'- AAAGAGAGTGTCTGTTTCAGCTCC -3'
(R):5'- TTTGAGGCCAAACTACAGGAAATTG -3'
Posted On2013-04-24