Incidental Mutation 'R4250:Hoxb5'
ID 321317
Institutional Source Beutler Lab
Gene Symbol Hoxb5
Ensembl Gene ENSMUSG00000038700
Gene Name homeobox B5
Synonyms Hox-2.1
MMRRC Submission 041066-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4250 (G1)
Quality Score 161
Status Not validated
Chromosome 11
Chromosomal Location 96194338-96196947 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96194854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 139 (S139P)
Ref Sequence ENSEMBL: ENSMUSP00000035423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000704] [ENSMUST00000049272] [ENSMUST00000173432]
AlphaFold P09079
Predicted Effect probably benign
Transcript: ENSMUST00000000704
SMART Domains Protein: ENSMUSP00000000704
Gene: ENSMUSG00000000690

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049272
AA Change: S139P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035423
Gene: ENSMUSG00000038700
AA Change: S139P

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 135 158 N/A INTRINSIC
HOX 194 256 1.63e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150698
Predicted Effect probably benign
Transcript: ENSMUST00000173432
SMART Domains Protein: ENSMUSP00000133281
Gene: ENSMUSG00000000690

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190470
Meta Mutation Damage Score 0.1541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in lung and gut development. Increased expression of this gene is associated with a distinct biologic subset of acute myeloid leukemia (AML) and the occurrence of bronchopulmonary sequestration (BPS) and congenital cystic adenomatoid malformation (CCAM) tissue. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a rostral shift of the shoulder girdle resulting in altered position of the forelimbs, and show variable anteriorizing homeotic transformations of cervicothoracic vertrebrae C6 through T1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1d C T 9: 88,613,706 (GRCm39) V23I probably benign Het
Birc2 A T 9: 7,818,936 (GRCm39) L552M probably benign Het
Chst3 A T 10: 60,021,890 (GRCm39) L319Q probably damaging Het
Col19a1 T C 1: 24,564,726 (GRCm39) T296A unknown Het
Colgalt2 A T 1: 152,365,638 (GRCm39) I313L probably benign Het
Dclre1b A C 3: 103,711,400 (GRCm39) probably null Het
Ezr A T 17: 7,022,196 (GRCm39) I94N probably damaging Het
Fry T G 5: 150,233,825 (GRCm39) I99S probably damaging Het
Hba-x T C 11: 32,228,000 (GRCm39) Y155H probably damaging Het
Herc3 T A 6: 58,893,501 (GRCm39) V921D probably damaging Het
Icam5 A G 9: 20,949,035 (GRCm39) T796A probably damaging Het
Igkv8-26 G A 6: 70,170,230 (GRCm39) V7I probably benign Het
Ikzf1 C T 11: 11,704,166 (GRCm39) T194M probably damaging Het
Kif14 G T 1: 136,401,126 (GRCm39) M492I possibly damaging Het
Lmtk3 G A 7: 45,443,486 (GRCm39) C723Y possibly damaging Het
Or5b97 T C 19: 12,878,368 (GRCm39) M259V probably benign Het
Padi2 A G 4: 140,633,857 (GRCm39) Y38C probably damaging Het
Pilra A T 5: 137,821,814 (GRCm39) S274T probably benign Het
Pkd1l1 C T 11: 8,815,543 (GRCm39) R1456K possibly damaging Het
Rreb1 T C 13: 38,077,869 (GRCm39) V27A possibly damaging Het
Rxfp1 A G 3: 79,559,579 (GRCm39) V414A probably benign Het
Satl1 A G X: 111,316,033 (GRCm39) S141P probably benign Het
Sirt1 T A 10: 63,172,877 (GRCm39) probably null Het
Slc5a6 A G 5: 31,195,062 (GRCm39) S512P probably benign Het
Snx8 A G 5: 140,341,800 (GRCm39) L121P probably damaging Het
Sp7 T A 15: 102,267,327 (GRCm39) T160S possibly damaging Het
Tcte1 A G 17: 45,850,617 (GRCm39) I298V probably benign Het
Trmt9b C A 8: 36,979,366 (GRCm39) T323K probably benign Het
Ttc4 G A 4: 106,522,880 (GRCm39) T346I probably damaging Het
Ttn T C 2: 76,544,056 (GRCm39) T32977A probably damaging Het
Yeats2 A G 16: 19,975,685 (GRCm39) K114E possibly damaging Het
Zdbf2 T C 1: 63,342,020 (GRCm39) V133A possibly damaging Het
Other mutations in Hoxb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Hoxb5 APN 11 96,194,818 (GRCm39) missense possibly damaging 0.74
IGL02608:Hoxb5 APN 11 96,195,969 (GRCm39) unclassified probably benign
IGL02876:Hoxb5 APN 11 96,194,594 (GRCm39) missense probably damaging 0.98
R0233:Hoxb5 UTSW 11 96,195,853 (GRCm39) missense probably benign 0.04
R0233:Hoxb5 UTSW 11 96,195,853 (GRCm39) missense probably benign 0.04
R0536:Hoxb5 UTSW 11 96,194,854 (GRCm39) missense possibly damaging 0.86
R1962:Hoxb5 UTSW 11 96,194,918 (GRCm39) missense probably benign 0.19
R3769:Hoxb5 UTSW 11 96,194,795 (GRCm39) missense possibly damaging 0.59
R4457:Hoxb5 UTSW 11 96,194,546 (GRCm39) missense probably damaging 1.00
R6515:Hoxb5 UTSW 11 96,195,908 (GRCm39) missense probably damaging 1.00
R9756:Hoxb5 UTSW 11 96,194,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATCTCAGCGTCAACCG -3'
(R):5'- GGGATCTATATTTGAGGCAAAGC -3'

Sequencing Primer
(F):5'- TCCTCCAGCCACTTTGGGG -3'
(R):5'- AGCCAAGCTTTGCTCGC -3'
Posted On 2015-06-12