Incidental Mutation 'R4105:Dnajb2'
ID321328
Institutional Source Beutler Lab
Gene Symbol Dnajb2
Ensembl Gene ENSMUSG00000026203
Gene NameDnaJ heat shock protein family (Hsp40) member B2
SynonymsmDj8, 2700059H22Rik, Dnajb10
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75236406-75245692 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 75236899 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 6 (E6*)
Ref Sequence ENSEMBL: ENSMUSP00000140566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055223] [ENSMUST00000082158] [ENSMUST00000180101] [ENSMUST00000185403] [ENSMUST00000185654] [ENSMUST00000187058] [ENSMUST00000188290] [ENSMUST00000188346] [ENSMUST00000188931] [ENSMUST00000191271]
Predicted Effect probably null
Transcript: ENSMUST00000055223
AA Change: E6*
SMART Domains Protein: ENSMUSP00000052520
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082158
AA Change: E6*
SMART Domains Protein: ENSMUSP00000080796
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180101
Predicted Effect probably null
Transcript: ENSMUST00000185403
AA Change: E6*
SMART Domains Protein: ENSMUSP00000139982
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 2.8e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185654
AA Change: E6*
SMART Domains Protein: ENSMUSP00000140456
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 1.3e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186600
Predicted Effect probably null
Transcript: ENSMUST00000187058
AA Change: E6*
SMART Domains Protein: ENSMUSP00000140637
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188290
AA Change: E6*
SMART Domains Protein: ENSMUSP00000140634
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188346
AA Change: E6*
SMART Domains Protein: ENSMUSP00000140588
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188628
Predicted Effect probably null
Transcript: ENSMUST00000188931
AA Change: E6*
SMART Domains Protein: ENSMUSP00000140566
Gene: ENSMUSG00000026203
AA Change: E6*

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190379
Predicted Effect probably benign
Transcript: ENSMUST00000190445
Predicted Effect probably benign
Transcript: ENSMUST00000191271
Meta Mutation Damage Score 0.734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Dnajb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb2 APN 1 75236890 missense probably damaging 1.00
R0494:Dnajb2 UTSW 1 75239634 unclassified probably benign
R2118:Dnajb2 UTSW 1 75237477 missense probably damaging 1.00
R3837:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3838:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3839:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R4108:Dnajb2 UTSW 1 75236899 nonsense probably null
R4858:Dnajb2 UTSW 1 75243554 missense possibly damaging 0.96
R7115:Dnajb2 UTSW 1 75243662 missense
Predicted Primers PCR Primer
(F):5'- GGGTTCAGATCGGGTTACTAGAC -3'
(R):5'- TGGTCTTCGTACTTTCCCAAGG -3'

Sequencing Primer
(F):5'- CAGATCGGGTTACTAGACTTAGG -3'
(R):5'- CGTACTTTCCCAAGGGTCTC -3'
Posted On2015-06-12