Incidental Mutation 'R4105:Fgf7'
ID321331
Institutional Source Beutler Lab
Gene Symbol Fgf7
Ensembl Gene ENSMUSG00000027208
Gene Namefibroblast growth factor 7
SynonymsKeratinocyte growth factor, Kgf
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126034658-126091185 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 126035679 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064794] [ENSMUST00000110442] [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably benign
Transcript: ENSMUST00000064794
SMART Domains Protein: ENSMUSP00000069681
Gene: ENSMUSG00000027208

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FGF 63 192 2.65e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110442
SMART Domains Protein: ENSMUSP00000106072
Gene: ENSMUSG00000027208

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FGF 63 192 2.65e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110446
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is a potent epithelial cell-specific growth factor, whose mitogenic activity is predominantly exhibited in keratinocytes but not in fibroblasts and endothelial cells. Studies of mouse and rat homologs of this gene implicated roles in morphogenesis of epithelium, reepithelialization of wounds, hair development and early lung organogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal coat appearance, kidney dysplasia, spleen hypoplasia, abnormal synaptic vesicle clustering and miniature inhibitory postsynaptic currents, increased susceptibility to drug-induced seizures, and impaired thymic recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Fgf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Fgf7 APN 2 126089445 missense probably damaging 0.98
IGL01121:Fgf7 APN 2 126088232 intron probably benign
IGL01328:Fgf7 APN 2 126088244 missense probably damaging 1.00
IGL01403:Fgf7 APN 2 126035940 missense probably damaging 1.00
IGL01664:Fgf7 APN 2 126035987 missense probably benign 0.01
R0245:Fgf7 UTSW 2 126035955 missense probably benign 0.05
R0652:Fgf7 UTSW 2 126035955 missense probably benign 0.05
R1528:Fgf7 UTSW 2 126035818 missense probably damaging 0.98
R4776:Fgf7 UTSW 2 126035783 nonsense probably null
R4974:Fgf7 UTSW 2 126088240 missense probably benign 0.00
R7293:Fgf7 UTSW 2 126035752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCACGACCTGTTTCTATAAGG -3'
(R):5'- AACTTCTGGTGTGTCGCTCG -3'

Sequencing Primer
(F):5'- GGATATACCTATCAGCTGTGTTCCTG -3'
(R):5'- TCGCTCGGGGCTGGAAC -3'
Posted On2015-06-12