Incidental Mutation 'R4105:Lrrcc1'
ID321333
Institutional Source Beutler Lab
Gene Symbol Lrrcc1
Ensembl Gene ENSMUSG00000027550
Gene Nameleucine rich repeat and coiled-coil domain containing 1
Synonyms
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14533788-14572658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14550328 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 73 (V73A)
Ref Sequence ENSEMBL: ENSMUSP00000129368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000167858] [ENSMUST00000169079]
Predicted Effect probably benign
Transcript: ENSMUST00000091325
AA Change: V478A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: V478A

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 126 4.8e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
coiled coil region 412 626 N/A INTRINSIC
coiled coil region 675 718 N/A INTRINSIC
coiled coil region 757 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108370
AA Change: V494A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: V494A

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 124 4.5e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163660
AA Change: V372A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: V372A

DomainStartEndE-ValueType
Blast:LRR 8 29 7e-6 BLAST
SCOP:d1dcea3 9 71 9e-4 SMART
low complexity region 167 179 N/A INTRINSIC
coiled coil region 306 520 N/A INTRINSIC
coiled coil region 569 612 N/A INTRINSIC
coiled coil region 651 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165436
SMART Domains Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Pfam:LRR_9 32 154 4e-10 PFAM
Pfam:LRR_6 60 83 1.4e-4 PFAM
Pfam:LRR_4 60 103 6.2e-11 PFAM
Pfam:LRR_8 60 116 8.1e-11 PFAM
Pfam:LRR_1 61 81 3.3e-4 PFAM
Pfam:LRR_6 78 105 3.4e-3 PFAM
Pfam:LRR_4 82 125 4.9e-9 PFAM
Pfam:LRR_6 103 125 5.1e-4 PFAM
Pfam:LRR_4 104 149 1.2e-8 PFAM
Pfam:LRR_1 105 128 3.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167858
AA Change: V73A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129368
Gene: ENSMUSG00000027550
AA Change: V73A

DomainStartEndE-ValueType
coiled coil region 7 221 N/A INTRINSIC
coiled coil region 270 313 N/A INTRINSIC
low complexity region 450 472 N/A INTRINSIC
SCOP:d1ek8a_ 494 550 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169079
AA Change: V494A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: V494A

DomainStartEndE-ValueType
Pfam:LRR_4 60 102 4.3e-9 PFAM
internal_repeat_1 109 145 1.05e-6 PROSPERO
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169799
SMART Domains Protein: ENSMUSP00000126592
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 1 131 N/A INTRINSIC
coiled coil region 200 228 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000171620
AA Change: V47A
SMART Domains Protein: ENSMUSP00000128252
Gene: ENSMUSG00000027550
AA Change: V47A

DomainStartEndE-ValueType
coiled coil region 30 91 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Lrrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Lrrcc1 APN 3 14536128 missense possibly damaging 0.91
IGL01325:Lrrcc1 APN 3 14536541 critical splice donor site probably null
IGL01681:Lrrcc1 APN 3 14548226 missense probably benign 0.35
IGL01767:Lrrcc1 APN 3 14547272 missense probably damaging 0.97
IGL01868:Lrrcc1 APN 3 14554357 nonsense probably null
IGL03123:Lrrcc1 APN 3 14536084 missense probably damaging 0.97
PIT1430001:Lrrcc1 UTSW 3 14545596 missense probably damaging 0.99
R0295:Lrrcc1 UTSW 3 14565849 missense probably benign 0.05
R0427:Lrrcc1 UTSW 3 14558356 missense probably damaging 1.00
R0433:Lrrcc1 UTSW 3 14559374 missense probably damaging 1.00
R0534:Lrrcc1 UTSW 3 14557273 missense probably damaging 1.00
R0631:Lrrcc1 UTSW 3 14540119 splice site probably benign
R0635:Lrrcc1 UTSW 3 14559228 missense probably benign 0.11
R1355:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1370:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1727:Lrrcc1 UTSW 3 14537363 missense probably damaging 0.99
R1822:Lrrcc1 UTSW 3 14559225 unclassified probably benign
R1946:Lrrcc1 UTSW 3 14550393 missense probably benign 0.02
R2254:Lrrcc1 UTSW 3 14547255 missense probably damaging 1.00
R2362:Lrrcc1 UTSW 3 14563024 missense probably damaging 1.00
R2392:Lrrcc1 UTSW 3 14536520 missense probably damaging 1.00
R4464:Lrrcc1 UTSW 3 14557318 missense probably damaging 1.00
R4484:Lrrcc1 UTSW 3 14551443 missense probably damaging 1.00
R4543:Lrrcc1 UTSW 3 14539791 missense probably damaging 0.98
R4718:Lrrcc1 UTSW 3 14536032 missense probably damaging 1.00
R4734:Lrrcc1 UTSW 3 14562285 missense probably damaging 1.00
R4799:Lrrcc1 UTSW 3 14536096 nonsense probably null
R4841:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R4842:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R5900:Lrrcc1 UTSW 3 14562126 missense possibly damaging 0.69
R6338:Lrrcc1 UTSW 3 14547316 missense possibly damaging 0.48
R7001:Lrrcc1 UTSW 3 14540095 missense probably damaging 0.99
R7036:Lrrcc1 UTSW 3 14563009 missense possibly damaging 0.80
R7342:Lrrcc1 UTSW 3 14554371 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGACAAAGGCATATACTGC -3'
(R):5'- TTTTAGGGGAAGCCATCAATCC -3'

Sequencing Primer
(F):5'- aGAGTTTGACAATACCTCAG -3'
(R):5'- AATCCGTTCTATCCACTGAGGGATAC -3'
Posted On2015-06-12