Incidental Mutation 'R4105:Ypel3'
ID321349
Institutional Source Beutler Lab
Gene Symbol Ypel3
Ensembl Gene ENSMUSG00000042675
Gene Nameyippee like 3
Synonyms1190001G19Rik, 0610043B10Rik, Suap
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126776955-126780514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126778093 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000101966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032944] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000106359] [ENSMUST00000132643] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352]
Predicted Effect probably benign
Transcript: ENSMUST00000032944
SMART Domains Protein: ENSMUSP00000032944
Gene: ENSMUSG00000030703

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:GDPD 44 202 1.1e-23 PFAM
low complexity region 208 216 N/A INTRINSIC
low complexity region 311 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038614
AA Change: S53P

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 6.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068836
Predicted Effect probably benign
Transcript: ENSMUST00000094037
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106356
AA Change: S53P

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106357
AA Change: S53P

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106359
AA Change: S82P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000132643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143078
Predicted Effect possibly damaging
Transcript: ENSMUST00000145762
AA Change: S53P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 103 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156891
Predicted Effect possibly damaging
Transcript: ENSMUST00000170882
AA Change: S53P

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172352
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206903
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Ypel3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Ypel3 APN 7 126777861 missense probably damaging 1.00
IGL03167:Ypel3 APN 7 126780075 missense probably damaging 1.00
Yelp UTSW 7 126778365 missense possibly damaging 0.93
R4084:Ypel3 UTSW 7 126778365 missense possibly damaging 0.93
R4911:Ypel3 UTSW 7 126777789 missense probably benign
R5435:Ypel3 UTSW 7 126775788 unclassified probably benign
R6119:Ypel3 UTSW 7 126778365 missense possibly damaging 0.93
R7372:Ypel3 UTSW 7 126780028 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAGACGTTTCAGGCCTACTTG -3'
(R):5'- AGCCACCCTCTAGCTAGTATG -3'

Sequencing Primer
(F):5'- AGGCCTACTTGGATGACTGTCAC -3'
(R):5'- AGCCACCCTCTAGCTAGTATGTTAAG -3'
Posted On2015-06-12