Incidental Mutation 'R4105:Gm2832'
ID321367
Institutional Source Beutler Lab
Gene Symbol Gm2832
Ensembl Gene ENSMUSG00000091110
Gene Namepredicted gene 2832
Synonyms
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4105 (G1)
Quality Score89
Status Not validated
Chromosome14
Chromosomal Location41278805-41288815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41280899 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 122 (M122L)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000172412
AA Change: M122L
SMART Domains Protein: ENSMUSP00000131087
Gene: ENSMUSG00000091110
AA Change: M122L

DomainStartEndE-ValueType
Pfam:Takusan 57 137 7.3e-26 PFAM
coiled coil region 156 185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Gm2832
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Gm2832 APN 14 41281713 missense unknown
R1997:Gm2832 UTSW 14 41280986 critical splice donor site probably null
R7024:Gm2832 UTSW 14 41279739 missense
Predicted Primers PCR Primer
(F):5'- CATTTGGTCCCCTGGATCTG -3'
(R):5'- AGAACTAGAGCTCTCACTTTTGTTC -3'

Sequencing Primer
(F):5'- TCTGCCCAAGATATTTAATCAGCAC -3'
(R):5'- GTTCAAAGTCTTAGAAGGTCACAAGC -3'
Posted On2015-06-12