Incidental Mutation 'R4105:Nfya'
ID321370
Institutional Source Beutler Lab
Gene Symbol Nfya
Ensembl Gene ENSMUSG00000023994
Gene Namenuclear transcription factor-Y alpha
SynonymsSez10, Cbf-b
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48386885-48409906 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 48392884 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 37 (Y37*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046719] [ENSMUST00000078800] [ENSMUST00000159063] [ENSMUST00000159535] [ENSMUST00000160319] [ENSMUST00000161117] [ENSMUST00000161256] [ENSMUST00000162460]
Predicted Effect probably benign
Transcript: ENSMUST00000046719
SMART Domains Protein: ENSMUSP00000043909
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 205 223 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
CBF 260 321 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078800
SMART Domains Protein: ENSMUSP00000077853
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 57 N/A INTRINSIC
low complexity region 98 166 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
CBF 259 320 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159063
SMART Domains Protein: ENSMUSP00000124404
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
CBF 225 286 3.92e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159237
AA Change: Y37*
SMART Domains Protein: ENSMUSP00000124115
Gene: ENSMUSG00000023994
AA Change: Y37*

DomainStartEndE-ValueType
low complexity region 66 84 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
CBF 121 182 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159535
SMART Domains Protein: ENSMUSP00000124501
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
internal_repeat_1 57 82 3.82e-6 PROSPERO
internal_repeat_1 74 95 3.82e-6 PROSPERO
low complexity region 97 165 N/A INTRINSIC
low complexity region 197 215 N/A INTRINSIC
low complexity region 218 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160319
SMART Domains Protein: ENSMUSP00000124245
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
low complexity region 220 234 N/A INTRINSIC
CBF 254 315 3.92e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160804
Predicted Effect probably benign
Transcript: ENSMUST00000161117
SMART Domains Protein: ENSMUSP00000124965
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
internal_repeat_1 24 49 2.33e-5 PROSPERO
internal_repeat_1 41 62 2.33e-5 PROSPERO
low complexity region 64 132 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161256
SMART Domains Protein: ENSMUSP00000125034
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 1 33 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
CBF 124 185 9.8e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161603
Predicted Effect probably benign
Transcript: ENSMUST00000162460
SMART Domains Protein: ENSMUSP00000123785
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
CBF 231 292 3.92e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163066
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus impairs development and results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Nfya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Nfya APN 17 48393255 unclassified probably benign
IGL02348:Nfya APN 17 48393276 nonsense probably null
IGL03220:Nfya APN 17 48400493 missense possibly damaging 0.66
IGL03274:Nfya APN 17 48391347 missense probably damaging 1.00
PIT4468001:Nfya UTSW 17 48395777 missense unknown
R0147:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0148:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0904:Nfya UTSW 17 48395787 nonsense probably null
R1484:Nfya UTSW 17 48393542 unclassified probably benign
R4108:Nfya UTSW 17 48392884 nonsense probably null
R4109:Nfya UTSW 17 48392884 nonsense probably null
R4923:Nfya UTSW 17 48400535 utr 5 prime probably benign
R5411:Nfya UTSW 17 48392018 missense possibly damaging 0.83
R6299:Nfya UTSW 17 48392910 intron probably benign
R6846:Nfya UTSW 17 48395687 missense probably benign 0.04
R6967:Nfya UTSW 17 48392904 intron probably benign
R7027:Nfya UTSW 17 48389312 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCAAGTGCCTTCTGCTG -3'
(R):5'- TTCCCACCACATCTGCAGTG -3'

Sequencing Primer
(F):5'- CACTGTGTTCTGCTAAGTTCAG -3'
(R):5'- ATCTGCAGTGACCGACCGTC -3'
Posted On2015-06-12