Incidental Mutation 'R4106:Sertad4'
ID321374
Institutional Source Beutler Lab
Gene Symbol Sertad4
Ensembl Gene ENSMUSG00000016262
Gene NameSERTA domain containing 4
SynonymsC130018M11Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R4106 (G1)
Quality Score101
Status Not validated
Chromosome1
Chromosomal Location192844488-192855756 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGAGGA at 192846742 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016406] [ENSMUST00000155503] [ENSMUST00000155579]
Predicted Effect probably benign
Transcript: ENSMUST00000016406
SMART Domains Protein: ENSMUSP00000016406
Gene: ENSMUSG00000016262

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
Pfam:SERTA 108 144 1.1e-18 PFAM
low complexity region 212 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155503
SMART Domains Protein: ENSMUSP00000142132
Gene: ENSMUSG00000016262

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
Pfam:SERTA 108 144 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155579
SMART Domains Protein: ENSMUSP00000116176
Gene: ENSMUSG00000016262

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
Pfam:SERTA 108 144 3.5e-20 PFAM
low complexity region 212 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190576
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Cacna1a A G 8: 84,583,695 I1461V possibly damaging Het
Cdc42bpb A C 12: 111,295,145 V107G probably benign Het
Cdhr4 A G 9: 107,996,260 D397G probably damaging Het
Chd1l T C 3: 97,597,703 T183A probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
H2-T24 A G 17: 36,017,478 S38P possibly damaging Het
Mapkapk3 A G 9: 107,257,066 V333A probably damaging Het
Muc5ac T G 7: 141,802,835 V1053G possibly damaging Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Nnt T C 13: 119,396,791 I113V probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1166 A T 2: 88,124,473 C171S possibly damaging Het
Rpl10a T A 17: 28,330,959 Y205N probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Sipa1l2 T C 8: 125,492,308 K97E probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a6 A G 19: 8,618,510 Q72R probably benign Het
St8sia2 A C 7: 73,960,761 L258R probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tcerg1l A G 7: 138,259,944 V352A probably damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tpp2 T C 1: 44,001,457 Y293H possibly damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Other mutations in Sertad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01974:Sertad4 APN 1 192846966 nonsense probably null
R1531:Sertad4 UTSW 1 192850950 critical splice donor site probably null
R1783:Sertad4 UTSW 1 192847032 missense probably benign 0.00
R5165:Sertad4 UTSW 1 192846822 missense possibly damaging 0.85
R5362:Sertad4 UTSW 1 192847106 missense probably damaging 1.00
R6243:Sertad4 UTSW 1 192850949 splice site probably null
Z1088:Sertad4 UTSW 1 192847031 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAATCAAGGTCGTTCCCCACAG -3'
(R):5'- TGGTCACTGCCTGAACCTAC -3'

Sequencing Primer
(F):5'- AGGGCATCACCATCTCTGCTG -3'
(R):5'- ACCCCTCTCTGTCAATACAAGTG -3'
Posted On2015-06-12