Incidental Mutation 'R4106:Olfr1166'
ID321378
Institutional Source Beutler Lab
Gene Symbol Olfr1166
Ensembl Gene ENSMUSG00000101078
Gene Nameolfactory receptor 1166
SynonymsGA_x6K02T2Q125-49616865-49615915, MOR174-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4106 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88123360-88128272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88124473 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 171 (C171S)
Ref Sequence ENSEMBL: ENSMUSP00000149099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099833] [ENSMUST00000217575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099833
AA Change: C171S

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097421
Gene: ENSMUSG00000101078
AA Change: C171S

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 6e-51 PFAM
Pfam:7tm_1 43 292 3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217575
AA Change: C171S

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Cacna1a A G 8: 84,583,695 I1461V possibly damaging Het
Cdc42bpb A C 12: 111,295,145 V107G probably benign Het
Cdhr4 A G 9: 107,996,260 D397G probably damaging Het
Chd1l T C 3: 97,597,703 T183A probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
H2-T24 A G 17: 36,017,478 S38P possibly damaging Het
Mapkapk3 A G 9: 107,257,066 V333A probably damaging Het
Muc5ac T G 7: 141,802,835 V1053G possibly damaging Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Nnt T C 13: 119,396,791 I113V probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Rpl10a T A 17: 28,330,959 Y205N probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Sertad4 AGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGA 1: 192,846,742 probably benign Het
Sipa1l2 T C 8: 125,492,308 K97E probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a6 A G 19: 8,618,510 Q72R probably benign Het
St8sia2 A C 7: 73,960,761 L258R probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tcerg1l A G 7: 138,259,944 V352A probably damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tpp2 T C 1: 44,001,457 Y293H possibly damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Other mutations in Olfr1166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1166 APN 2 88124679 missense probably damaging 1.00
R1037:Olfr1166 UTSW 2 88124229 missense probably damaging 0.97
R1452:Olfr1166 UTSW 2 88124311 missense probably benign 0.01
R1842:Olfr1166 UTSW 2 88124127 missense probably damaging 1.00
R2005:Olfr1166 UTSW 2 88124547 missense probably damaging 1.00
R4930:Olfr1166 UTSW 2 88124340 missense probably benign 0.08
R5473:Olfr1166 UTSW 2 88124637 missense possibly damaging 0.94
R5911:Olfr1166 UTSW 2 88124683 missense probably benign
R6596:Olfr1166 UTSW 2 88124199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGAAGATTGATATGGCAGTCAG -3'
(R):5'- GTTCATGTTAGCAGTGATGGCC -3'

Sequencing Primer
(F):5'- ACAGGTGGAGAAGGCTTTTC -3'
(R):5'- CATGTTAGCAGTGATGGCCTATGAC -3'
Posted On2015-06-12