Incidental Mutation 'R4106:Cdhr4'
ID321397
Institutional Source Beutler Lab
Gene Symbol Cdhr4
Ensembl Gene ENSMUSG00000032595
Gene Namecadherin-related family member 4
SynonymsCdh29, 1700021K14Rik, D330022A01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4106 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107992497-107999684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107996260 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 397 (D397G)
Ref Sequence ENSEMBL: ENSMUSP00000135184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175759] [ENSMUST00000176306] [ENSMUST00000176356] [ENSMUST00000176373] [ENSMUST00000177173] [ENSMUST00000177368] [ENSMUST00000177508]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175729
Predicted Effect unknown
Transcript: ENSMUST00000175759
AA Change: D34G
SMART Domains Protein: ENSMUSP00000135743
Gene: ENSMUSG00000032595
AA Change: D34G

DomainStartEndE-ValueType
Blast:CA 3 104 4e-44 BLAST
SCOP:d1l3wa3 59 104 4e-7 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175802
SMART Domains Protein: ENSMUSP00000135003
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
CA 33 116 5.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176196
Predicted Effect probably benign
Transcript: ENSMUST00000176306
Predicted Effect probably benign
Transcript: ENSMUST00000176334
Predicted Effect probably benign
Transcript: ENSMUST00000176356
Predicted Effect probably benign
Transcript: ENSMUST00000176373
SMART Domains Protein: ENSMUSP00000134896
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000176459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177093
Predicted Effect probably damaging
Transcript: ENSMUST00000177173
AA Change: D397G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135184
Gene: ENSMUSG00000032595
AA Change: D397G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Blast:CA 149 224 2e-9 BLAST
Blast:CA 252 330 3e-33 BLAST
CA 354 437 2.24e-1 SMART
CA 459 542 5.86e-17 SMART
Blast:CA 566 649 3e-40 BLAST
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177226
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177508
SMART Domains Protein: ENSMUSP00000135332
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 1 29 4e-7 BLAST
transmembrane domain 60 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177516
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Cacna1a A G 8: 84,583,695 I1461V possibly damaging Het
Cdc42bpb A C 12: 111,295,145 V107G probably benign Het
Chd1l T C 3: 97,597,703 T183A probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
H2-T24 A G 17: 36,017,478 S38P possibly damaging Het
Mapkapk3 A G 9: 107,257,066 V333A probably damaging Het
Muc5ac T G 7: 141,802,835 V1053G possibly damaging Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Nnt T C 13: 119,396,791 I113V probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1166 A T 2: 88,124,473 C171S possibly damaging Het
Rpl10a T A 17: 28,330,959 Y205N probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Sertad4 AGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGA 1: 192,846,742 probably benign Het
Sipa1l2 T C 8: 125,492,308 K97E probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a6 A G 19: 8,618,510 Q72R probably benign Het
St8sia2 A C 7: 73,960,761 L258R probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tcerg1l A G 7: 138,259,944 V352A probably damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tpp2 T C 1: 44,001,457 Y293H possibly damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Other mutations in Cdhr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdhr4 APN 9 107999545 missense probably damaging 1.00
IGL01105:Cdhr4 APN 9 107995861 unclassified probably benign
IGL02097:Cdhr4 APN 9 107993000 missense probably benign 0.17
IGL02441:Cdhr4 APN 9 107993267 missense possibly damaging 0.84
IGL02635:Cdhr4 APN 9 107992871 missense probably benign 0.04
IGL02870:Cdhr4 APN 9 107998064 critical splice donor site probably null
IGL03160:Cdhr4 APN 9 107995869 missense probably benign 0.05
IGL03162:Cdhr4 APN 9 107998011 missense probably damaging 1.00
IGL03250:Cdhr4 APN 9 107996659 missense probably damaging 0.99
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R1241:Cdhr4 UTSW 9 107995296 missense probably benign 0.00
R1250:Cdhr4 UTSW 9 107997516 missense probably damaging 1.00
R2102:Cdhr4 UTSW 9 107998007 missense probably damaging 1.00
R2104:Cdhr4 UTSW 9 107996261 missense probably damaging 0.97
R2106:Cdhr4 UTSW 9 107997494 missense possibly damaging 0.75
R2108:Cdhr4 UTSW 9 107997644 missense probably damaging 1.00
R2171:Cdhr4 UTSW 9 107992918 missense probably benign 0.00
R2312:Cdhr4 UTSW 9 107995287 missense probably benign 0.00
R4515:Cdhr4 UTSW 9 107992951 missense probably benign 0.31
R4686:Cdhr4 UTSW 9 107995684 missense probably benign 0.00
R4799:Cdhr4 UTSW 9 107998699 splice site probably benign
R5165:Cdhr4 UTSW 9 107997630 missense probably damaging 1.00
R5478:Cdhr4 UTSW 9 107995591 missense possibly damaging 0.61
R5574:Cdhr4 UTSW 9 107993328 unclassified probably benign
R7387:Cdhr4 UTSW 9 107996912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATACTCCATGCAGGCAAAGTG -3'
(R):5'- CCTGACCTTCTAGCTTTCGAGG -3'

Sequencing Primer
(F):5'- CCAAGGTTTGTTGGCATTGAGAAC -3'
(R):5'- CCTTCTAGCTTTCGAGGGGAAAAAG -3'
Posted On2015-06-12