Incidental Mutation 'R4106:Rpl10a'
ID321403
Institutional Source Beutler Lab
Gene Symbol Rpl10a
Ensembl Gene ENSMUSG00000037805
Gene Nameribosomal protein L10A
SynonymsCsA-19, Nedd6
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R4106 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28328471-28331032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28330959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 205 (Y205N)
Ref Sequence ENSEMBL: ENSMUSP00000048469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000088007] [ENSMUST00000114799] [ENSMUST00000114801] [ENSMUST00000114803] [ENSMUST00000114804] [ENSMUST00000123248] [ENSMUST00000129935] [ENSMUST00000146104] [ENSMUST00000154873] [ENSMUST00000156505] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect probably benign
Transcript: ENSMUST00000042334
AA Change: Y205N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805
AA Change: Y205N

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088007
SMART Domains Protein: ENSMUSP00000085322
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 212 5.9e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114799
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114801
SMART Domains Protein: ENSMUSP00000110449
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 98 1.8e-32 PFAM
Pfam:FA_FANCE 93 125 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114803
SMART Domains Protein: ENSMUSP00000110451
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 167 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114804
SMART Domains Protein: ENSMUSP00000110452
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 140 3.7e-56 PFAM
Pfam:FA_FANCE 137 170 6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123248
SMART Domains Protein: ENSMUSP00000119663
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 154 3.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128758
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143443
Predicted Effect probably benign
Transcript: ENSMUST00000146104
SMART Domains Protein: ENSMUSP00000114386
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 96 7.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152665
Predicted Effect probably benign
Transcript: ENSMUST00000154873
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156505
SMART Domains Protein: ENSMUSP00000118622
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 67 4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156569
Predicted Effect probably benign
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219703
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L1P family of ribosomal proteins. It is located in the cytoplasm. The expression of this gene is downregulated in the thymus by cyclosporin-A (CsA), an immunosuppressive drug. Studies in mice have shown that the expression of the ribosomal protein L10a gene is downregulated in neural precursor cells during development. This gene previously was referred to as NEDD6 (neural precursor cell expressed, developmentally downregulated 6), but it has been renamed RPL10A (ribosomal protein 10a). As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Cacna1a A G 8: 84,583,695 I1461V possibly damaging Het
Cdc42bpb A C 12: 111,295,145 V107G probably benign Het
Cdhr4 A G 9: 107,996,260 D397G probably damaging Het
Chd1l T C 3: 97,597,703 T183A probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
H2-T24 A G 17: 36,017,478 S38P possibly damaging Het
Mapkapk3 A G 9: 107,257,066 V333A probably damaging Het
Muc5ac T G 7: 141,802,835 V1053G possibly damaging Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Nnt T C 13: 119,396,791 I113V probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1166 A T 2: 88,124,473 C171S possibly damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Sertad4 AGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGA 1: 192,846,742 probably benign Het
Sipa1l2 T C 8: 125,492,308 K97E probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a6 A G 19: 8,618,510 Q72R probably benign Het
St8sia2 A C 7: 73,960,761 L258R probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tcerg1l A G 7: 138,259,944 V352A probably damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tpp2 T C 1: 44,001,457 Y293H possibly damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Other mutations in Rpl10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Rpl10a APN 17 28329007 missense probably damaging 1.00
IGL02955:Rpl10a APN 17 28328993 missense probably damaging 0.99
R4921:Rpl10a UTSW 17 28330852 missense probably benign 0.15
R5057:Rpl10a UTSW 17 28330633 missense probably benign 0.00
R6352:Rpl10a UTSW 17 28330846 missense possibly damaging 0.56
R6932:Rpl10a UTSW 17 28329450 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGAGCTAGGTCTGGGTGC -3'
(R):5'- ACCACCTGAGAAGCATTGTAGAC -3'

Sequencing Primer
(F):5'- TAAGCCTTTTCACTGGGGGAAAG -3'
(R):5'- TGAGAAGCATTGTAGACCCCTAC -3'
Posted On2015-06-12