Incidental Mutation 'R4108:Pik3c2g'
ID321467
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 040987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4108 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 139730370 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 80 (A80E)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111868]
Predicted Effect probably benign
Transcript: ENSMUST00000111868
AA Change: A80E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: A80E

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187069
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,225,934 Y82C probably damaging Het
4930579F01Rik T C 3: 138,183,670 N62S probably benign Het
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atp4b A G 8: 13,396,640 probably null Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Caskin1 C A 17: 24,502,147 T487K probably benign Het
Ccr7 C T 11: 99,145,378 M239I probably damaging Het
Cdh23 C A 10: 60,410,822 V944L possibly damaging Het
Cenpf A G 1: 189,683,868 S87P probably damaging Het
Chd9 A T 8: 91,010,676 D1461V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5r2 A T 7: 107,753,929 M102K probably damaging Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Dtx4 G A 19: 12,501,123 A32V probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Eml6 A C 11: 29,805,136 S880A probably damaging Het
Fsd2 C T 7: 81,544,967 V483I probably benign Het
Inf2 T C 12: 112,607,581 L773P unknown Het
Kif26b A G 1: 178,916,965 Q1095R possibly damaging Het
Leprotl1 A G 8: 34,140,759 probably null Het
Lrp1b A G 2: 40,665,087 V340A unknown Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Ncstn G T 1: 172,072,544 N254K probably damaging Het
Nfatc1 T A 18: 80,698,368 H139L possibly damaging Het
Nfe2l1 C T 11: 96,819,394 probably null Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr11 A G 13: 21,638,782 V247A probably damaging Het
Olfr844 T A 9: 19,319,312 Y265* probably null Het
Otogl C T 10: 107,771,244 V2093I probably benign Het
Phc2 A G 4: 128,707,983 Y77C probably damaging Het
Plxnd1 G T 6: 115,959,315 H1675N probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Ppp1r12c T C 7: 4,486,566 D199G probably damaging Het
Prss22 A G 17: 23,993,873 Y297H probably benign Het
Psmb7 T A 2: 38,642,199 H78L probably damaging Het
Rad51ap2 T C 12: 11,458,395 C773R probably damaging Het
Rpl12 A T 2: 32,961,824 N8Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sbf1 T C 15: 89,288,585 probably benign Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1a G A 7: 127,799,202 probably benign Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slc34a2 G A 5: 53,064,009 V266I possibly damaging Het
Smtn G A 11: 3,526,449 T144I probably benign Het
Spta1 A G 1: 174,174,556 N84S probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tbcd T A 11: 121,493,811 H39Q probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tsg101 T A 7: 46,892,494 D99V probably damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Ubald1 C A 16: 4,875,867 M61I probably benign Het
Ush1c C T 7: 46,198,445 D465N probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps54 A G 11: 21,312,877 I655V probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGAGGTAACAGGTCATTG -3'
(R):5'- GAACAAGGGTCATCTTTTCTTAGG -3'

Sequencing Primer
(F):5'- CCAGAGGTAACAGGTCATTGTGTTG -3'
(R):5'- AGGTTTGTCGGTATAGCCAGAATAG -3'
Posted On2015-06-12