Incidental Mutation 'R4108:Supt16'
ID321496
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Namesuppressor of Ty 16
SynonymsSupt16h, Spt16, Fact140, Cdc68
MMRRC Submission 040987-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.980) question?
Stock #R4108 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52160414-52197416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52162731 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 985 (E985G)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709] [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181017] [ENSMUST00000181401]
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: E985G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: E985G

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111600
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111603
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180500
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180901
SMART Domains Protein: ENSMUSP00000137826
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 179 223 N/A INTRINSIC
coiled coil region 274 363 N/A INTRINSIC
Blast:C2 526 654 2e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181017
SMART Domains Protein: ENSMUSP00000137900
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Blast:C2 126 254 2e-41 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181401
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227577
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,225,934 Y82C probably damaging Het
4930579F01Rik T C 3: 138,183,670 N62S probably benign Het
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atp4b A G 8: 13,396,640 probably null Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Caskin1 C A 17: 24,502,147 T487K probably benign Het
Ccr7 C T 11: 99,145,378 M239I probably damaging Het
Cdh23 C A 10: 60,410,822 V944L possibly damaging Het
Cenpf A G 1: 189,683,868 S87P probably damaging Het
Chd9 A T 8: 91,010,676 D1461V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5r2 A T 7: 107,753,929 M102K probably damaging Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Dtx4 G A 19: 12,501,123 A32V probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Eml6 A C 11: 29,805,136 S880A probably damaging Het
Fsd2 C T 7: 81,544,967 V483I probably benign Het
Inf2 T C 12: 112,607,581 L773P unknown Het
Kif26b A G 1: 178,916,965 Q1095R possibly damaging Het
Leprotl1 A G 8: 34,140,759 probably null Het
Lrp1b A G 2: 40,665,087 V340A unknown Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Ncstn G T 1: 172,072,544 N254K probably damaging Het
Nfatc1 T A 18: 80,698,368 H139L possibly damaging Het
Nfe2l1 C T 11: 96,819,394 probably null Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr11 A G 13: 21,638,782 V247A probably damaging Het
Olfr844 T A 9: 19,319,312 Y265* probably null Het
Otogl C T 10: 107,771,244 V2093I probably benign Het
Phc2 A G 4: 128,707,983 Y77C probably damaging Het
Pik3c2g C A 6: 139,730,370 A80E probably benign Het
Plxnd1 G T 6: 115,959,315 H1675N probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Ppp1r12c T C 7: 4,486,566 D199G probably damaging Het
Prss22 A G 17: 23,993,873 Y297H probably benign Het
Psmb7 T A 2: 38,642,199 H78L probably damaging Het
Rad51ap2 T C 12: 11,458,395 C773R probably damaging Het
Rpl12 A T 2: 32,961,824 N8Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sbf1 T C 15: 89,288,585 probably benign Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1a G A 7: 127,799,202 probably benign Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slc34a2 G A 5: 53,064,009 V266I possibly damaging Het
Smtn G A 11: 3,526,449 T144I probably benign Het
Spta1 A G 1: 174,174,556 N84S probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tbcd T A 11: 121,493,811 H39Q probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tsg101 T A 7: 46,892,494 D99V probably damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Ubald1 C A 16: 4,875,867 M61I probably benign Het
Ush1c C T 7: 46,198,445 D465N probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps54 A G 11: 21,312,877 I655V probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCCTCAAACAGTTTCATAGTG -3'
(R):5'- CTTGAGGGGCATTAGACATCC -3'

Sequencing Primer
(F):5'- ACAGTTTCATAGTGTTCTTTCCAAC -3'
(R):5'- GGCATTAGACATCCTCAGGC -3'
Posted On2015-06-12