Incidental Mutation 'R4161:Kif16b'
ID321511
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Namekinesin family member 16B
Synonyms8430434E15Rik, N-3 kinesin
MMRRC Submission 041004-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location142617474-142901531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142707404 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1064 (H1064Y)
Ref Sequence ENSEMBL: ENSMUSP00000148731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
Predicted Effect probably benign
Transcript: ENSMUST00000043589
AA Change: H1064Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: H1064Y

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211861
AA Change: H1064Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212106
Predicted Effect probably benign
Transcript: ENSMUST00000230763
AA Change: H1075Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,518,509 K86N probably damaging Het
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Ackr2 A G 9: 121,909,522 Y321C probably benign Het
Angptl3 T C 4: 99,031,491 S163P probably damaging Het
Ankle2 T C 5: 110,234,368 M70T probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Ano8 A T 8: 71,482,637 I339N probably damaging Het
Cxcl2 A T 5: 90,904,022 probably null Het
Exosc3 T C 4: 45,320,619 probably benign Het
Fat1 G A 8: 45,036,787 A3579T probably benign Het
Fat4 G A 3: 38,942,809 V1726I possibly damaging Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Grm7 A G 6: 111,254,020 N468S probably damaging Het
Hmgcll1 A T 9: 76,074,916 probably benign Het
Igkv3-12 T A 6: 70,518,558 V23E probably benign Het
Irx6 T C 8: 92,676,291 C95R possibly damaging Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Plec T C 15: 76,179,651 E2141G possibly damaging Het
Pou6f1 A G 15: 100,580,843 S395P probably damaging Het
Prss12 A T 3: 123,485,527 K418* probably null Het
Rtn3 G A 19: 7,483,079 A2V probably benign Het
Rubcnl A G 14: 75,044,458 T452A possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Spred3 A G 7: 29,161,785 L323P probably damaging Het
Srprb A G 9: 103,201,330 F67S possibly damaging Het
Tk2 T C 8: 104,238,833 S101G probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Trpm7 A G 2: 126,816,831 L1135P probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Usp38 C T 8: 80,993,338 A421T probably damaging Het
Vcan G T 13: 89,685,158 N3058K probably damaging Het
Vmn1r221 G A 13: 23,218,006 noncoding transcript Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zbtb10 T C 3: 9,280,296 S707P probably damaging Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATCAGCTGAATGTTGAG -3'
(R):5'- GGATGCCTGAAACTCTTGTTC -3'

Sequencing Primer
(F):5'- GAATGTTGAGTACCTGGCATCCATC -3'
(R):5'- GATGCCTGAAACTCTTGTTCTGTGC -3'
Posted On2015-06-12