Mutagenetix > Incidental Mutation

Incidental Mutation 'R4161:Grm7'

321522

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

6330570A01Rik, Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik

MMRRC Submission

041004-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110622542-111544191 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111230981 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 468 (N468S)

Ref Sequence

ENSEMBL: ENSMUSP00000064404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: N468S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: N468S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172951
AA Change: N468S

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: N468S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174018

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Meta Mutation Damage Score

0.3072

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (39/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,738,588 (GRCm39)	Y321C	probably benign	Het
Angptl3	T	C	4: 98,919,728 (GRCm39)	S163P	probably damaging	Het
Ankle2	T	C	5: 110,382,234 (GRCm39)	M70T	probably benign	Het
Ankrd1	T	A	19: 36,095,273 (GRCm39)	K138N	probably damaging	Het
Ano8	A	T	8: 71,935,281 (GRCm39)	I339N	probably damaging	Het
Bltp3a	A	G	17: 28,103,061 (GRCm39)	Y365C	probably damaging	Het
Cxcl2	A	T	5: 91,051,881 (GRCm39)		probably null	Het
Exosc3	T	C	4: 45,320,619 (GRCm39)		probably benign	Het
Fads2b	C	A	2: 85,348,853 (GRCm39)	K86N	probably damaging	Het
Fat1	G	A	8: 45,489,824 (GRCm39)	A3579T	probably benign	Het
Fat4	G	A	3: 38,996,958 (GRCm39)	V1726I	possibly damaging	Het
Hmgcll1	A	T	9: 75,982,198 (GRCm39)		probably benign	Het
Igkv3-12	T	A	6: 70,495,542 (GRCm39)	V23E	probably benign	Het
Irx6	T	C	8: 93,402,919 (GRCm39)	C95R	possibly damaging	Het
Kif16b	G	A	2: 142,549,324 (GRCm39)	H1064Y	probably benign	Het
Lrrc45	A	T	11: 120,609,272 (GRCm39)	D377V	possibly damaging	Het
Oasl1	A	G	5: 115,075,073 (GRCm39)	K378E	possibly damaging	Het
Pds5a	T	C	5: 65,821,839 (GRCm39)	T120A	possibly damaging	Het
Phf8-ps	G	A	17: 33,285,023 (GRCm39)	T593I	probably benign	Het
Plec	T	C	15: 76,063,851 (GRCm39)	E2141G	possibly damaging	Het
Pou6f1	A	G	15: 100,478,724 (GRCm39)	S395P	probably damaging	Het
Prss12	A	T	3: 123,279,176 (GRCm39)	K418*	probably null	Het
Rtn3	G	A	19: 7,460,444 (GRCm39)	A2V	probably benign	Het
Rubcnl	A	G	14: 75,281,898 (GRCm39)	T452A	possibly damaging	Het
Sdk1	A	G	5: 142,100,154 (GRCm39)	I1395V	probably benign	Het
Senp7	C	A	16: 55,973,832 (GRCm39)	P351Q	possibly damaging	Het
Slco1a7	T	C	6: 141,654,322 (GRCm39)	K647E	probably benign	Het
Spred3	A	G	7: 28,861,210 (GRCm39)	L323P	probably damaging	Het
Srprb	A	G	9: 103,078,529 (GRCm39)	F67S	possibly damaging	Het
Tk2	T	C	8: 104,965,465 (GRCm39)	S101G	probably benign	Het
Tnxb	A	G	17: 34,930,491 (GRCm39)	T2059A	probably damaging	Het
Trpm7	A	G	2: 126,658,751 (GRCm39)	L1135P	probably damaging	Het
Ush2a	G	A	1: 188,460,907 (GRCm39)	V2723M	probably damaging	Het
Usp38	C	T	8: 81,719,967 (GRCm39)	A421T	probably damaging	Het
Vcan	G	T	13: 89,833,277 (GRCm39)	N3058K	probably damaging	Het
Vmn1r221	G	A	13: 23,402,176 (GRCm39)		noncoding transcript	Het
Vps11	C	G	9: 44,267,017 (GRCm39)	G406A	probably damaging	Het
Wnk2	C	T	13: 49,244,313 (GRCm39)	D508N	probably damaging	Het
Zbtb10	T	C	3: 9,345,356 (GRCm39)	S707P	probably damaging	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111,223,145 (GRCm39)	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111,335,278 (GRCm39)	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111,335,919 (GRCm39)	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111,472,604 (GRCm39)	splice site	probably null
IGL03185:Grm7	APN	6	110,623,183 (GRCm39)	missense	possibly damaging	0.84
Appropriated	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
Consumed	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
Devoured	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
Ravaged	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
shaky	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110,623,050 (GRCm39)	missense	probably benign
R0539:Grm7	UTSW	6	111,336,055 (GRCm39)	splice site	probably benign
R0622:Grm7	UTSW	6	111,335,457 (GRCm39)	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111,335,985 (GRCm39)	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
R1823:Grm7	UTSW	6	111,184,730 (GRCm39)	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111,057,384 (GRCm39)	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111,335,568 (GRCm39)	missense	probably benign
R1987:Grm7	UTSW	6	110,891,472 (GRCm39)	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111,184,769 (GRCm39)	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110,623,098 (GRCm39)	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111,335,958 (GRCm39)	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R2923:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R3014:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111,472,683 (GRCm39)	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110,891,301 (GRCm39)	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4329:Grm7	UTSW	6	110,891,325 (GRCm39)	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111,223,335 (GRCm39)	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111,335,265 (GRCm39)	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110,891,507 (GRCm39)	splice site	probably null
R4647:Grm7	UTSW	6	110,891,344 (GRCm39)	nonsense	probably null
R4714:Grm7	UTSW	6	111,057,383 (GRCm39)	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110,891,332 (GRCm39)	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111,335,824 (GRCm39)	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111,057,404 (GRCm39)	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110,623,097 (GRCm39)	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111,335,182 (GRCm39)	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111,335,387 (GRCm39)	missense	probably benign
R6026:Grm7	UTSW	6	111,478,500 (GRCm39)	nonsense	probably null
R6174:Grm7	UTSW	6	111,223,258 (GRCm39)	missense	probably benign
R6305:Grm7	UTSW	6	111,335,626 (GRCm39)	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111,184,713 (GRCm39)	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111,335,386 (GRCm39)	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111,335,314 (GRCm39)	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	111,472,690 (GRCm39)	missense	probably damaging	1.00
R6949:Grm7	UTSW	6	110,623,265 (GRCm39)	missense	probably benign	0.03
R6989:Grm7	UTSW	6	111,184,766 (GRCm39)	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111,335,113 (GRCm39)	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110,623,079 (GRCm39)	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110,622,974 (GRCm39)	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111,478,476 (GRCm39)	missense
R7567:Grm7	UTSW	6	111,335,722 (GRCm39)	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111,223,314 (GRCm39)	nonsense	probably null
R8018:Grm7	UTSW	6	111,184,737 (GRCm39)	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111,543,000 (GRCm39)	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110,891,297 (GRCm39)	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111,057,315 (GRCm39)	missense	probably benign
R8523:Grm7	UTSW	6	111,223,280 (GRCm39)	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111,230,966 (GRCm39)	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111,472,783 (GRCm39)	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111,472,729 (GRCm39)	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110,622,869 (GRCm39)	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111,231,077 (GRCm39)	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111,335,193 (GRCm39)	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111,335,451 (GRCm39)	missense	probably damaging	1.00
Z1176:Grm7	UTSW	6	111,335,110 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGGCTTAGAATGAAAAGCTTCTG -3'
(R):5'- GCATGCGTGGTTCTATACATGG -3'

Sequencing Primer
(F):5'- GCTTCTGAAAGATCATGAATAAAGCC -3'
(R):5'- CGTGGTTCTATACATGGAAAAGCAC -3'

Posted On

2015-06-12