Incidental Mutation 'R0398:Acr'
ID32156
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Nameacrosin prepropeptide
Synonymspreproacrosin
MMRRC Submission 038603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0398 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89568326-89574585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89573941 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 275 (V275G)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
Predicted Effect probably damaging
Transcript: ENSMUST00000023295
AA Change: V275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: V275G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230538
Predicted Effect probably benign
Transcript: ENSMUST00000230978
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 83.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,445,367 R724G probably benign Het
Abcb11 T C 2: 69,286,666 Q546R probably null Het
Adam5 A G 8: 24,813,432 Y160H probably benign Het
Adcy5 T A 16: 35,269,068 M545K probably damaging Het
Aoc2 A G 11: 101,325,553 E154G possibly damaging Het
Atg2a T G 19: 6,246,578 L338R probably damaging Het
Atp2a1 T C 7: 126,450,418 probably benign Het
Bbs7 A G 3: 36,590,717 S436P probably benign Het
Bpnt1 T C 1: 185,338,158 Y16H probably benign Het
Cbll1 A T 12: 31,492,092 F90Y probably damaging Het
Cbs G T 17: 31,617,242 Q411K probably benign Het
Cdca2 A C 14: 67,697,962 F435V probably damaging Het
Cdh13 T G 8: 119,314,047 S664A probably damaging Het
Cdk17 T A 10: 93,237,840 V438E probably benign Het
Cep295 T C 9: 15,354,736 D40G possibly damaging Het
Col6a1 T C 10: 76,710,118 H840R unknown Het
Cpa1 A G 6: 30,645,251 T409A probably benign Het
Crlf1 G A 8: 70,499,089 probably benign Het
E2f2 T A 4: 136,180,544 I184N probably damaging Het
Ehbp1 T C 11: 22,095,886 D596G probably damaging Het
Ets2 A G 16: 95,716,223 Y333C probably damaging Het
Fam178b A G 1: 36,632,406 probably benign Het
Fndc3b A G 3: 27,461,779 V626A probably benign Het
Gart G T 16: 91,639,449 A140E probably damaging Het
Gbp7 T C 3: 142,545,513 S477P possibly damaging Het
Gm16380 T C 9: 53,884,169 noncoding transcript Het
Hmcn1 C A 1: 150,798,814 R579M possibly damaging Het
Hoxb8 A C 11: 96,283,111 H50P probably damaging Het
Hspa4 C T 11: 53,272,879 probably null Het
Hspa4l G A 3: 40,756,997 probably benign Het
Hyal4 A T 6: 24,756,671 Y296F probably damaging Het
Igsf8 C A 1: 172,317,499 T131K probably damaging Het
Ilvbl C T 10: 78,579,539 P298L probably damaging Het
Jak2 T A 19: 29,282,388 I229N possibly damaging Het
Kif1b T C 4: 149,204,231 D1205G possibly damaging Het
Lrrc63 T C 14: 75,126,470 R74G probably benign Het
Lvrn A G 18: 46,880,693 T481A probably benign Het
Macf1 T A 4: 123,351,017 T7312S probably damaging Het
Magel2 C T 7: 62,380,551 Q1068* probably null Het
Mrpl3 A G 9: 105,064,103 Y203C probably damaging Het
Nek2 T A 1: 191,827,361 I326N probably benign Het
Nlrc4 A C 17: 74,445,920 N489K probably damaging Het
Nlrp4f A T 13: 65,194,918 S304R possibly damaging Het
Ogfr C G 2: 180,593,699 R189G probably damaging Het
Olfr1151 A T 2: 87,858,057 N294I probably damaging Het
Olfr506 T A 7: 108,612,955 I216N probably benign Het
Olfr548-ps1 T A 7: 102,542,692 L252H probably damaging Het
Orm3 A G 4: 63,357,648 S145G probably benign Het
Pclo A G 5: 14,681,702 E3406G unknown Het
Pcx T G 19: 4,601,610 F4C probably benign Het
Pgd C A 4: 149,153,882 G364V probably damaging Het
Pla2g12a C A 3: 129,890,396 D102E probably benign Het
Pnpo A T 11: 96,942,427 C82* probably null Het
Prdm1 T C 10: 44,439,809 N792S probably damaging Het
Prim2 A T 1: 33,484,676 probably benign Het
Proca1 C A 11: 78,205,268 P242Q probably benign Het
Psmc5 A G 11: 106,261,544 N129S probably benign Het
Ptchd4 A G 17: 42,377,259 T231A possibly damaging Het
Qrfpr C T 3: 36,181,052 probably benign Het
Rab44 G A 17: 29,145,370 probably benign Het
Racgap1 T C 15: 99,628,627 probably benign Het
Rapgef4 A G 2: 72,031,041 E25G probably damaging Het
Rpl8 G C 15: 76,905,046 probably benign Het
Samd12 G A 15: 53,719,720 P73S possibly damaging Het
Samd9l T A 6: 3,374,502 N920Y probably damaging Het
Sdk1 T C 5: 141,962,721 V607A probably benign Het
Slc25a19 A G 11: 115,617,575 Y196H probably damaging Het
Slc39a3 A T 10: 81,033,787 M12K possibly damaging Het
Slc5a4a T C 10: 76,182,722 I501T possibly damaging Het
Sp4 A T 12: 118,298,673 V546D possibly damaging Het
Ssh3 C T 19: 4,263,699 V511M possibly damaging Het
Stard9 T G 2: 120,696,307 V1015G probably benign Het
Thoc5 G T 11: 4,921,978 V516F possibly damaging Het
Ttc21a T A 9: 119,954,562 I570N probably damaging Het
Ttc4 T C 4: 106,667,573 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Yipf3 A G 17: 46,251,485 E298G possibly damaging Het
Zbtb34 C A 2: 33,411,048 E494* probably null Het
Zfhx3 A G 8: 108,951,246 Y2976C probably damaging Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89573250 missense probably benign 0.19
IGL00857:Acr APN 15 89570002 missense probably benign 0.00
IGL01353:Acr APN 15 89569492 missense probably damaging 1.00
IGL01466:Acr APN 15 89573994 missense probably benign
IGL01599:Acr APN 15 89568414 missense probably benign 0.01
IGL02408:Acr APN 15 89570014 missense probably damaging 1.00
R0042:Acr UTSW 15 89574332 missense probably benign
R0520:Acr UTSW 15 89573227 missense probably damaging 1.00
R0578:Acr UTSW 15 89569475 missense probably damaging 1.00
R0579:Acr UTSW 15 89569475 missense probably damaging 1.00
R1167:Acr UTSW 15 89573974 missense probably damaging 1.00
R1792:Acr UTSW 15 89573143 missense probably benign 0.00
R2006:Acr UTSW 15 89574201 missense probably benign 0.00
R5531:Acr UTSW 15 89573943 missense probably damaging 1.00
R5577:Acr UTSW 15 89574238 missense probably benign 0.01
R7033:Acr UTSW 15 89569500 missense probably benign 0.03
R7206:Acr UTSW 15 89574171 missense probably benign
R7484:Acr UTSW 15 89573224 missense probably damaging 0.99
R7548:Acr UTSW 15 89574393 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CATCTTATTGCAAGGCACCTCAGGG -3'
(R):5'- GTTTGTTGGAAAGGGGCTCAAACG -3'

Sequencing Primer
(F):5'- GGATGTTTGCAGCTCTTACC -3'
(R):5'- CATAGGGTAAGTTCTCATCTTCAGG -3'
Posted On2013-04-24