Incidental Mutation 'R4162:Gli3'
ID321576
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 041005-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4162 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15725115 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 1029 (S1029I)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: S1029I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S1029I

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T A 10: 83,506,654 I431F possibly damaging Het
Atrn A G 2: 130,994,228 probably benign Het
BC017643 T C 11: 121,224,666 D109G probably damaging Het
Cep57 C T 9: 13,812,633 probably null Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,217,778 probably benign Het
Grin2d T C 7: 45,857,618 K478E probably damaging Het
Il18 T C 9: 50,579,412 S116P probably damaging Het
Itsn1 C A 16: 91,852,902 P155T probably benign Het
Kdm5b C T 1: 134,625,161 P1292S probably benign Het
Mb21d1 G A 9: 78,434,404 R364C probably damaging Het
Mef2b T C 8: 70,166,311 F181S probably damaging Het
Mfn1 T C 3: 32,562,998 probably benign Het
Mfsd12 A G 10: 81,361,097 probably null Het
Myo10 T A 15: 25,726,415 probably null Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Pank4 T C 4: 154,979,594 probably null Het
Plcb2 T A 2: 118,709,587 E1075V probably damaging Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tex15 T C 8: 33,581,558 S2378P probably damaging Het
Tex45 C T 8: 3,479,067 P214L probably damaging Het
Thap12 C T 7: 98,710,078 probably benign Het
Trav3-1 T C 14: 52,581,039 Y57H probably damaging Het
Ttc39c A G 18: 12,724,937 probably null Het
Tubgcp3 C T 8: 12,639,547 R573Q possibly damaging Het
Ush2a A C 1: 188,743,680 K2938T probably benign Het
Vasp A T 7: 19,259,472 probably null Het
Zfhx3 C A 8: 108,956,987 T3686K unknown Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense not run
R7085:Gli3 UTSW 13 15715062 missense not run
Predicted Primers PCR Primer
(F):5'- AGCCTGAAGACCAAGATGGC -3'
(R):5'- CAAGTTAGCATCAGCATCCATGG -3'

Sequencing Primer
(F):5'- CAAGATGGCCTTGCTAGGG -3'
(R):5'- TTAGCATCAGCATCCATGGTCAGAG -3'
Posted On2015-06-12