Incidental Mutation 'R4164:Smarcal1'
ID 321640
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene Name SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms Mharp, 6030401P21Rik
MMRRC Submission 041638-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4164 (G1)
Quality Score 164
Status Validated
Chromosome 1
Chromosomal Location 72622410-72672293 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 72665848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000152225]
AlphaFold Q8BJL0
Predicted Effect probably benign
Transcript: ENSMUST00000047615
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect probably benign
Transcript: ENSMUST00000152225
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,780,863 (GRCm39) A164T probably benign Het
Ash1l A G 3: 88,889,273 (GRCm39) D384G probably damaging Het
Cntn5 A G 9: 9,781,681 (GRCm39) V666A probably damaging Het
Defb41 C T 1: 18,330,821 (GRCm39) C42Y probably damaging Het
Dennd4c C A 4: 86,725,764 (GRCm39) N739K probably benign Het
Dnah6 C T 6: 73,066,575 (GRCm39) W2598* probably null Het
Ell G T 8: 71,034,223 (GRCm39) R30L probably damaging Het
Entrep1 G A 19: 23,952,993 (GRCm39) A439V probably damaging Het
Entrep1 C T 19: 23,953,002 (GRCm39) S436N probably damaging Het
Fer1l6 A C 15: 58,431,087 (GRCm39) R247S possibly damaging Het
Flnb A T 14: 7,915,374 (GRCm38) I1502F possibly damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2223 C T X: 32,943,247 (GRCm39) noncoding transcript Het
Ifi203 A T 1: 173,756,029 (GRCm39) probably benign Het
Ighm T A 12: 113,385,915 (GRCm39) E108V unknown Het
Il23r T A 6: 67,400,647 (GRCm39) Q561L probably benign Het
Kank1 A G 19: 25,388,436 (GRCm39) D703G probably benign Het
Kcnt2 A T 1: 140,537,368 (GRCm39) Y1109F probably damaging Het
Lamb2 T A 9: 108,367,497 (GRCm39) Y1760N probably damaging Het
Lrpprc T C 17: 85,038,617 (GRCm39) E950G possibly damaging Het
Lrrc66 T A 5: 73,787,119 (GRCm39) probably null Het
Mtbp T C 15: 55,472,917 (GRCm39) V627A probably benign Het
Myo10 T A 15: 25,726,501 (GRCm39) probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nipbl T C 15: 8,368,418 (GRCm39) N1142S probably benign Het
Nrxn2 G A 19: 6,582,173 (GRCm39) V660I probably damaging Het
Oas1c T C 5: 120,946,204 (GRCm39) E98G probably damaging Het
Or8a1b T G 9: 37,622,994 (GRCm39) I194L probably benign Het
Otx1 A G 11: 21,946,638 (GRCm39) probably benign Het
Prkcd A G 14: 30,323,154 (GRCm39) F461L probably damaging Het
Prune2 T C 19: 16,981,098 (GRCm39) F85S possibly damaging Het
Rnf214 G A 9: 45,783,210 (GRCm39) R184W probably damaging Het
Scn5a T C 9: 119,324,844 (GRCm39) N1328S probably damaging Het
Secisbp2l T C 2: 125,593,803 (GRCm39) probably benign Het
Snx21 T C 2: 164,628,770 (GRCm39) Y138H probably damaging Het
Sox5 T A 6: 144,062,206 (GRCm39) R149W probably damaging Het
Spout1 C T 2: 30,067,589 (GRCm39) probably benign Het
Tlr1 A G 5: 65,084,545 (GRCm39) C11R possibly damaging Het
Vmn2r23 A T 6: 123,706,697 (GRCm39) H509L probably benign Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72,655,724 (GRCm39) missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72,625,290 (GRCm39) missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72,655,679 (GRCm39) nonsense probably null
IGL02007:Smarcal1 APN 1 72,635,099 (GRCm39) missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72,672,214 (GRCm39) utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72,659,247 (GRCm39) missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72,638,094 (GRCm39) splice site probably null
IGL03135:Smarcal1 APN 1 72,655,660 (GRCm39) splice site probably null
IGL03306:Smarcal1 APN 1 72,665,625 (GRCm39) missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72,672,010 (GRCm39) missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72,634,970 (GRCm39) nonsense probably null
R0396:Smarcal1 UTSW 1 72,665,632 (GRCm39) missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72,638,015 (GRCm39) missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72,625,120 (GRCm39) missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72,625,258 (GRCm39) missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72,665,755 (GRCm39) missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72,665,755 (GRCm39) missense possibly damaging 0.88
R4438:Smarcal1 UTSW 1 72,650,637 (GRCm39) intron probably benign
R4722:Smarcal1 UTSW 1 72,650,496 (GRCm39) missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72,636,599 (GRCm39) missense probably benign
R4989:Smarcal1 UTSW 1 72,672,019 (GRCm39) missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72,630,242 (GRCm39) missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72,635,135 (GRCm39) critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72,638,068 (GRCm39) missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72,665,776 (GRCm39) missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72,630,412 (GRCm39) missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72,625,372 (GRCm39) missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72,630,296 (GRCm39) missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72,655,716 (GRCm39) missense possibly damaging 0.82
R6447:Smarcal1 UTSW 1 72,625,033 (GRCm39) missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72,630,332 (GRCm39) missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72,652,101 (GRCm39) missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72,625,179 (GRCm39) missense probably benign 0.08
R7975:Smarcal1 UTSW 1 72,652,150 (GRCm39) missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72,665,722 (GRCm39) missense probably damaging 1.00
R8407:Smarcal1 UTSW 1 72,640,554 (GRCm39) missense probably benign 0.04
R8901:Smarcal1 UTSW 1 72,624,939 (GRCm39) missense possibly damaging 0.71
R9329:Smarcal1 UTSW 1 72,665,697 (GRCm39) missense probably damaging 0.99
R9548:Smarcal1 UTSW 1 72,671,999 (GRCm39) missense possibly damaging 0.84
Z1177:Smarcal1 UTSW 1 72,630,426 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACACATCCGGATCGATGG -3'
(R):5'- CACTTGCAGAACATGTCATCTTC -3'

Sequencing Primer
(F):5'- ATCCGGATCGATGGCTCCAC -3'
(R):5'- TGCCTGCATGCATGTGC -3'
Posted On 2015-06-12