Incidental Mutation 'R4165:Gm5174'
ID321701
Institutional Source Beutler Lab
Gene Symbol Gm5174
Ensembl Gene ENSMUSG00000090308
Gene Namepredicted gene 5174
Synonyms
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4165 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86655939-86657381 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 86656933 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171131
SMART Domains Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

DomainStartEndE-ValueType
S_TKc 14 262 5.59e-86 SMART
UBA 276 313 1.28e-3 SMART
low complexity region 447 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219608
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Gm5174
AlleleSourceChrCoordTypePredicted EffectPPH Score
Laco UTSW 10 86656108 unclassified noncoding transcript
R1083:Gm5174 UTSW 10 86656108 unclassified noncoding transcript
R1199:Gm5174 UTSW 10 86657325 unclassified noncoding transcript
R1296:Gm5174 UTSW 10 86657002 unclassified noncoding transcript
R1715:Gm5174 UTSW 10 86656912 unclassified noncoding transcript
R1957:Gm5174 UTSW 10 86656753 unclassified noncoding transcript
R2221:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R2223:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R3104:Gm5174 UTSW 10 86656655 unclassified noncoding transcript
R4166:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4243:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R4244:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R5024:Gm5174 UTSW 10 86656587 unclassified noncoding transcript
R5292:Gm5174 UTSW 10 86656698 unclassified noncoding transcript
R5586:Gm5174 UTSW 10 86656545 unclassified noncoding transcript
R5864:Gm5174 UTSW 10 86657181 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATTGAGAAACATCCTTGGGTCAC -3'
(R):5'- GAGGCATGGAGTCACTTCTG -3'

Sequencing Primer
(F):5'- ACATCCTTGGGTCACGAAATG -3'
(R):5'- GCATGGAGTCACTTCTGGTCAAC -3'
Posted On2015-06-12