Mutagenetix > Incidental Mutation

Incidental Mutation 'R4165:Gm5174'

321701

Institutional Source

Beutler Lab

Gene Symbol

Gm5174

Ensembl Gene

ENSMUSG00000090308

Gene Name

predicted gene 5174

Synonyms

MMRRC Submission

041007-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R4165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86491822-86493244 bp(+) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 86492797 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171131

SMART Domains

Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

Domain	Start	End	E-Value	Type
S_TKc	14	262	5.59e-86	SMART
UBA	276	313	1.28e-3	SMART
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219608

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

97% (38/39)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,827,044 (GRCm39)	F4I	probably damaging	Het
Adamts8	G	T	9: 30,862,684 (GRCm39)	E296D	probably benign	Het
Alg11	T	C	8: 22,555,573 (GRCm39)	V278A	probably damaging	Het
Ankfy1	G	A	11: 72,605,310 (GRCm39)		probably null	Het
Avil	C	T	10: 126,842,496 (GRCm39)	Q92*	probably null	Het
Cfap300	A	T	9: 8,026,071 (GRCm39)	L167Q	probably damaging	Het
CK137956	A	T	4: 127,864,522 (GRCm39)	S36T	possibly damaging	Het
Epb41l3	T	C	17: 69,514,883 (GRCm39)	S7P	probably damaging	Het
Espl1	A	G	15: 102,221,424 (GRCm39)	I944V	probably damaging	Het
Fsd2	T	C	7: 81,195,608 (GRCm39)	T434A	probably damaging	Het
Gpaa1	A	C	15: 76,216,667 (GRCm39)		probably benign	Het
Grina	T	A	15: 76,133,529 (GRCm39)	L334Q	probably damaging	Het
Gvin-ps5	T	A	7: 105,929,895 (GRCm39)		noncoding transcript	Het
Igkv15-103	G	T	6: 68,414,824 (GRCm39)	G88*	probably null	Het
Ip6k2	G	A	9: 108,682,847 (GRCm39)	R319Q	probably benign	Het
Kdm3b	A	T	18: 34,928,797 (GRCm39)	I183F	probably benign	Het
Kyat3	A	G	3: 142,432,066 (GRCm39)		probably null	Het
Larp7	A	G	3: 127,330,611 (GRCm39)	Y569H	probably benign	Het
Loxhd1	A	T	18: 77,460,025 (GRCm39)	I758F	probably damaging	Het
Nr1d2	T	C	14: 18,215,446 (GRCm38)	I189V	probably benign	Het
Odad2	A	T	18: 7,217,008 (GRCm39)	I668K	probably damaging	Het
Pcdhb19	T	A	18: 37,632,243 (GRCm39)	N679K	probably benign	Het
Pigr	G	A	1: 130,769,554 (GRCm39)	D122N	probably benign	Het
Prap1	T	A	7: 139,676,091 (GRCm39)	V35E	probably benign	Het
Prdm1	T	A	10: 44,317,572 (GRCm39)	Y417F	probably benign	Het
Ralgapa1	C	T	12: 55,687,429 (GRCm39)	R2019Q	probably damaging	Het
Rps3	T	C	7: 99,132,816 (GRCm39)	I5V	probably benign	Het
Sema3a	A	T	5: 13,523,364 (GRCm39)		probably null	Het
Serpina3g	A	T	12: 104,206,546 (GRCm39)	T116S	probably benign	Het
Skint11	C	A	4: 114,101,856 (GRCm39)	Q99K	probably benign	Het
Slc22a28	A	G	19: 8,040,773 (GRCm39)	S493P	possibly damaging	Het
Snapc1	G	T	12: 74,029,354 (GRCm39)		probably null	Het
Sobp	C	T	10: 42,897,644 (GRCm39)	G647D	probably damaging	Het
Tomm22	C	A	15: 79,555,206 (GRCm39)		probably benign	Het
Trappc11	T	C	8: 47,978,003 (GRCm39)		probably benign	Het
Txnl4a	T	A	18: 80,265,471 (GRCm39)	M112K	probably benign	Het
Vmn2r16	T	C	5: 109,478,427 (GRCm39)	F61L	possibly damaging	Het
Zfp709	C	T	8: 72,644,649 (GRCm39)	Q693*	probably null	Het

Other mutations in Gm5174

Allele	Source	Chr	Coord	Type	Predicted Effect
Laco	UTSW	10	86,491,972 (GRCm39)	unclassified	noncoding transcript
R1083:Gm5174	UTSW	10	86,491,972 (GRCm39)	unclassified	noncoding transcript
R1199:Gm5174	UTSW	10	86,493,189 (GRCm39)	unclassified	noncoding transcript
R1296:Gm5174	UTSW	10	86,492,866 (GRCm39)	unclassified	noncoding transcript
R1715:Gm5174	UTSW	10	86,492,776 (GRCm39)	unclassified	noncoding transcript
R1957:Gm5174	UTSW	10	86,492,617 (GRCm39)	unclassified	noncoding transcript
R2221:Gm5174	UTSW	10	86,492,372 (GRCm39)	unclassified	noncoding transcript
R2223:Gm5174	UTSW	10	86,492,372 (GRCm39)	unclassified	noncoding transcript
R3104:Gm5174	UTSW	10	86,492,519 (GRCm39)	unclassified	noncoding transcript
R4166:Gm5174	UTSW	10	86,492,797 (GRCm39)	unclassified	noncoding transcript
R4243:Gm5174	UTSW	10	86,492,144 (GRCm39)	unclassified	noncoding transcript
R4244:Gm5174	UTSW	10	86,492,144 (GRCm39)	unclassified	noncoding transcript
R5024:Gm5174	UTSW	10	86,492,451 (GRCm39)	unclassified	noncoding transcript
R5292:Gm5174	UTSW	10	86,492,562 (GRCm39)	unclassified	noncoding transcript
R5586:Gm5174	UTSW	10	86,492,409 (GRCm39)	unclassified	noncoding transcript
R5864:Gm5174	UTSW	10	86,493,045 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- ATTGAGAAACATCCTTGGGTCAC -3'
(R):5'- GAGGCATGGAGTCACTTCTG -3'

Sequencing Primer
(F):5'- ACATCCTTGGGTCACGAAATG -3'
(R):5'- GCATGGAGTCACTTCTGGTCAAC -3'

Posted On

2015-06-12