Incidental Mutation 'R4256:Fbxo3'
ID321809
Institutional Source Beutler Lab
Gene Symbol Fbxo3
Ensembl Gene ENSMUSG00000027180
Gene NameF-box protein 3
SynonymsFba, 1200002G09Rik, 1700026K02Rik
MMRRC Submission 041069-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R4256 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104027721-104063240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104051165 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000099625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028603] [ENSMUST00000102565] [ENSMUST00000111135] [ENSMUST00000111136]
Predicted Effect probably damaging
Transcript: ENSMUST00000028603
AA Change: T281A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028603
Gene: ENSMUSG00000027180
AA Change: T281A

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 294 384 3.1e-30 PFAM
coiled coil region 417 446 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102565
AA Change: T281A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099625
Gene: ENSMUSG00000027180
AA Change: T281A

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 385 1.8e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111135
AA Change: T276A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106765
Gene: ENSMUSG00000027180
AA Change: T276A

DomainStartEndE-ValueType
SCOP:d1fs1a1 14 48 4e-3 SMART
Blast:FBOX 16 51 2e-13 BLAST
SMI1_KNR4 116 246 3.02e-5 SMART
Pfam:DUF525 288 380 1.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111136
AA Change: T281A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106766
Gene: ENSMUSG00000027180
AA Change: T281A

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 361 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143799
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Fbxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Fbxo3 APN 2 104033676 missense probably benign 0.25
IGL02187:Fbxo3 APN 2 104027950 missense probably damaging 0.99
IGL02323:Fbxo3 APN 2 104047951 missense probably benign 0.38
IGL02941:Fbxo3 APN 2 104050294 missense probably damaging 1.00
IGL03160:Fbxo3 APN 2 104030347 nonsense probably null
IGL03346:Fbxo3 APN 2 104050294 missense probably damaging 1.00
R2163:Fbxo3 UTSW 2 104054985 missense probably benign 0.20
R2899:Fbxo3 UTSW 2 104051135 missense probably damaging 1.00
R4663:Fbxo3 UTSW 2 104053475 missense probably damaging 1.00
R4914:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4915:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4918:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R7001:Fbxo3 UTSW 2 104051224 missense probably damaging 1.00
R7223:Fbxo3 UTSW 2 104043012 missense possibly damaging 0.86
R7226:Fbxo3 UTSW 2 104050297 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGACCATGATGGCTGTCTATAC -3'
(R):5'- GTTCACCAAAGTTGATTCCTCG -3'

Sequencing Primer
(F):5'- ATGGCTGTCTATACTGAACCAGG -3'
(R):5'- CACTGACTAGCACACAGT -3'
Posted On2015-06-20