Incidental Mutation 'R4257:L3mbtl3'
ID321866
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4257 (G1)
Quality Score161
Status Validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26280122 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 754 (Q754L)
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: Q754L
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: Q754L

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: Q729L
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: Q729L

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: Q754L
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: Q754L

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218585
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arhgap24 A G 5: 102,664,117 E70G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm5414 A G 15: 101,624,672 L440P probably damaging Het
Gm6563 A G 19: 23,675,975 E43G possibly damaging Het
Gm9755 A T 8: 67,514,477 noncoding transcript Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Olfr1176 A C 2: 88,340,277 K237N probably damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Upp2 A T 2: 58,780,094 I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
R7490:L3mbtl3 UTSW 10 26339231 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGCTCCATTTGGAAACTCTACTAG -3'
(R):5'- AGCATGCTCAACCTCCTCAG -3'

Sequencing Primer
(F):5'- CCATTTGGAAACTCTACTAGCTGGG -3'
(R):5'- TCCTCAGCAGGCACAGAAGG -3'
Posted On2015-06-20