Incidental Mutation 'R4258:Smarcd2'
ID321912
Institutional Source Beutler Lab
Gene Symbol Smarcd2
Ensembl Gene ENSMUSG00000078619
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
SynonymsBaf60b
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R4258 (G1)
Quality Score202
Status Validated
Chromosome11
Chromosomal Location106263179-106272972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106265250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 292 (I292N)
Ref Sequence ENSEMBL: ENSMUSP00000102456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021049] [ENSMUST00000021052] [ENSMUST00000106843] [ENSMUST00000133131] [ENSMUST00000140255]
Predicted Effect probably benign
Transcript: ENSMUST00000021049
SMART Domains Protein: ENSMUSP00000021049
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021052
AA Change: I339N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021052
Gene: ENSMUSG00000078619
AA Change: I339N

DomainStartEndE-ValueType
low complexity region 5 42 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 122 131 N/A INTRINSIC
Blast:KISc 136 287 2e-36 BLAST
SWIB 307 386 1.3e-21 SMART
Blast:MYSc 468 514 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106841
Predicted Effect probably damaging
Transcript: ENSMUST00000106843
AA Change: I292N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102456
Gene: ENSMUSG00000078619
AA Change: I292N

DomainStartEndE-ValueType
low complexity region 75 84 N/A INTRINSIC
Blast:KISc 89 240 1e-36 BLAST
SWIB 260 339 1.3e-21 SMART
Blast:MYSc 421 467 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132278
Predicted Effect probably benign
Transcript: ENSMUST00000133131
SMART Domains Protein: ENSMUSP00000138057
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140255
AA Change: I61N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133629
Gene: ENSMUSG00000078619
AA Change: I61N

DomainStartEndE-ValueType
SWIB 29 108 1.3e-21 SMART
Blast:MYSc 190 236 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174253
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Smarcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Smarcd2 APN 11 106265904 missense probably damaging 1.00
IGL01880:Smarcd2 APN 11 106266677 missense probably damaging 1.00
R0357:Smarcd2 UTSW 11 106267332 critical splice donor site probably null
R0626:Smarcd2 UTSW 11 106267415 missense probably benign 0.10
R1524:Smarcd2 UTSW 11 106267152 missense probably benign 0.01
R1822:Smarcd2 UTSW 11 106267396 missense probably benign 0.00
R2072:Smarcd2 UTSW 11 106265307 nonsense probably null
R2074:Smarcd2 UTSW 11 106265307 nonsense probably null
R2359:Smarcd2 UTSW 11 106267164 missense probably benign 0.01
R3960:Smarcd2 UTSW 11 106266575 missense probably damaging 1.00
R4211:Smarcd2 UTSW 11 106266905 nonsense probably null
R4822:Smarcd2 UTSW 11 106266531 splice site probably null
R5174:Smarcd2 UTSW 11 106267045 unclassified probably benign
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAAGGCACGGTGATATCAGC -3'
(R):5'- GGGTGCAGGGTCCTTTTAAC -3'

Sequencing Primer
(F):5'- CACGGTGATATCAGCCTGAG -3'
(R):5'- AACTCAGCAGTTCTTAACCTGTGGG -3'
Posted On2015-06-20