Incidental Mutation 'R4283:Slc17a6'
ID321952
Institutional Source Beutler Lab
Gene Symbol Slc17a6
Ensembl Gene ENSMUSG00000030500
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms2900073D12Rik, VGLUT2
MMRRC Submission 041651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4283 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location51622006-51671119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51645076 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 177 (Y177C)
Ref Sequence ENSEMBL: ENSMUSP00000146364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]
Predicted Effect probably damaging
Transcript: ENSMUST00000032710
AA Change: Y177C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500
AA Change: Y177C

DomainStartEndE-ValueType
Pfam:MFS_1 76 461 6.5e-50 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207375
Predicted Effect probably damaging
Transcript: ENSMUST00000207945
AA Change: Y177C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208597
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,261 T229A probably benign Het
Adgrg5 T G 8: 94,937,698 V312G probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Camk2b A C 11: 5,987,099 S327A probably benign Het
Card9 A G 2: 26,357,297 I280T possibly damaging Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cga T C 4: 34,905,264 probably null Het
Copg1 C T 6: 87,908,545 T723M probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Crtc2 A G 3: 90,259,236 probably benign Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Ghr C A 15: 3,333,448 V181L possibly damaging Het
Gm10750 A G 2: 149,015,996 F112L unknown Het
Gm17541 A G 12: 4,689,656 probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hdac10 A G 15: 89,125,623 L402P possibly damaging Het
Hsd17b12 G C 2: 94,033,586 R304G unknown Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Ncaph A G 2: 127,121,085 probably benign Het
Ninl T C 2: 150,953,416 probably benign Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pcsk4 C A 10: 80,329,453 probably benign Het
Ptpn21 T C 12: 98,733,475 E60G probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Tas2r104 C T 6: 131,685,411 A112T probably damaging Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tas2r143 T A 6: 42,401,073 probably null Het
Tfeb A G 17: 47,789,774 E305G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Upf2 A G 2: 5,973,558 N411S unknown Het
Vmn2r52 C T 7: 10,170,638 G425R possibly damaging Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Slc17a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Slc17a6 APN 7 51669115 missense probably benign 0.15
IGL01653:Slc17a6 APN 7 51668022 missense possibly damaging 0.92
IGL01993:Slc17a6 APN 7 51667957 missense possibly damaging 0.51
IGL02082:Slc17a6 APN 7 51669029 missense probably benign 0.00
IGL02212:Slc17a6 APN 7 51667470 missense possibly damaging 0.94
IGL02544:Slc17a6 APN 7 51666155 nonsense probably null
IGL02585:Slc17a6 APN 7 51625349 missense probably benign 0.00
IGL03206:Slc17a6 APN 7 51666023 splice site probably benign
IGL03396:Slc17a6 APN 7 51669092 missense probably damaging 1.00
R0137:Slc17a6 UTSW 7 51666144 missense probably benign 0.00
R0141:Slc17a6 UTSW 7 51669067 missense probably benign 0.10
R0207:Slc17a6 UTSW 7 51646180 intron probably benign
R0362:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R0841:Slc17a6 UTSW 7 51625315 missense probably benign 0.29
R1037:Slc17a6 UTSW 7 51649248 splice site probably benign
R1325:Slc17a6 UTSW 7 51661552 missense probably benign 0.15
R1614:Slc17a6 UTSW 7 51646277 intron probably benign
R1625:Slc17a6 UTSW 7 51661460 missense probably benign 0.00
R1736:Slc17a6 UTSW 7 51661585 splice site probably benign
R1777:Slc17a6 UTSW 7 51646209 missense possibly damaging 0.63
R1824:Slc17a6 UTSW 7 51661546 missense probably damaging 1.00
R2249:Slc17a6 UTSW 7 51667906 missense probably damaging 1.00
R4910:Slc17a6 UTSW 7 51658741 missense possibly damaging 0.78
R5301:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R5523:Slc17a6 UTSW 7 51626850 nonsense probably null
R5570:Slc17a6 UTSW 7 51658756 missense probably benign 0.00
R5720:Slc17a6 UTSW 7 51625397 missense probably damaging 1.00
R5736:Slc17a6 UTSW 7 51645093 missense possibly damaging 0.78
R5765:Slc17a6 UTSW 7 51625501 missense possibly damaging 0.93
R6380:Slc17a6 UTSW 7 51667463 missense probably benign 0.02
R6989:Slc17a6 UTSW 7 51661476 missense possibly damaging 0.88
R7178:Slc17a6 UTSW 7 51667511 missense possibly damaging 0.58
R7194:Slc17a6 UTSW 7 51626892 missense probably damaging 1.00
R7325:Slc17a6 UTSW 7 51645018 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTGATTGCTTTTGGCCTACC -3'
(R):5'- CCCTGAGTTTGAGGACCAAG -3'

Sequencing Primer
(F):5'- GATTGCTTTTGGCCTACCCTTTTG -3'
(R):5'- TTTGAGGACCAAGAACATTGACC -3'
Posted On2015-06-20