Incidental Mutation 'R4283:Ric1'
ID321970
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
MMRRC Submission 041651-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R4283 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29586550 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 568 (Y568C)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably damaging
Transcript: ENSMUST00000043610
AA Change: Y568C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: Y568C

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162492
AA Change: Y459C
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: Y459C

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,261 T229A probably benign Het
Adgrg5 T G 8: 94,937,698 V312G probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Camk2b A C 11: 5,987,099 S327A probably benign Het
Card9 A G 2: 26,357,297 I280T possibly damaging Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cga T C 4: 34,905,264 probably null Het
Copg1 C T 6: 87,908,545 T723M probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Crtc2 A G 3: 90,259,236 probably benign Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Ghr C A 15: 3,333,448 V181L possibly damaging Het
Gm10750 A G 2: 149,015,996 F112L unknown Het
Gm17541 A G 12: 4,689,656 probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hdac10 A G 15: 89,125,623 L402P possibly damaging Het
Hsd17b12 G C 2: 94,033,586 R304G unknown Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Ncaph A G 2: 127,121,085 probably benign Het
Ninl T C 2: 150,953,416 probably benign Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pcsk4 C A 10: 80,329,453 probably benign Het
Ptpn21 T C 12: 98,733,475 E60G probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Slc17a6 A G 7: 51,645,076 Y177C probably damaging Het
Tas2r104 C T 6: 131,685,411 A112T probably damaging Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tas2r143 T A 6: 42,401,073 probably null Het
Tfeb A G 17: 47,789,774 E305G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Upf2 A G 2: 5,973,558 N411S unknown Het
Vmn2r52 C T 7: 10,170,638 G425R possibly damaging Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGATCTGATACGTGGTCTC -3'
(R):5'- TTCCTCCCCATAACACAGGG -3'

Sequencing Primer
(F):5'- GATCTGATACGTGGTCTCATAATTC -3'
(R):5'- GAGAAAAGCAGGTTCTTGTGC -3'
Posted On2015-06-20