Incidental Mutation 'R4285:Dlc1'
ID322031
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4285 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36574128 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1316 (E1316K)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
Predicted Effect probably benign
Transcript: ENSMUST00000033923
AA Change: E865K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: E865K

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098826
AA Change: E899K

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: E899K

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156312
Predicted Effect possibly damaging
Transcript: ENSMUST00000163663
AA Change: E1316K

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: E1316K

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kctd19 G A 8: 105,382,949 probably benign Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Man2a2 T C 7: 80,368,619 D141G probably damaging Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr164 A C 16: 19,285,964 F260V probably damaging Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Samm50 T C 15: 84,197,012 V47A probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vat1l A G 8: 114,205,783 E23G probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGTCATAGCCACAGGAACG -3'
(R):5'- TCCATGTCAGCCCTGTTGTG -3'

Sequencing Primer
(F):5'- CCAGGGAGAAGACTGACCTTC -3'
(R):5'- ATGTCAGCCCTGTTGTGAATAC -3'
Posted On2015-06-20