Incidental Mutation 'R4287:Itgav'
ID322049
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 83724840 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 36 (E36*)
Ref Sequence ENSEMBL: ENSMUSP00000122730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740] [ENSMUST00000141725]
Predicted Effect probably null
Transcript: ENSMUST00000028499
AA Change: E36*
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: E36*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111740
AA Change: E36*
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: E36*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125360
Predicted Effect probably null
Transcript: ENSMUST00000141725
AA Change: E36*
SMART Domains Protein: ENSMUSP00000122730
Gene: ENSMUSG00000027087
AA Change: E36*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 103 4.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155521
Meta Mutation Damage Score 0.6084 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGTTCCGAGGTACTGTGCTC -3'
(R):5'- GTTTCATCCATGCCAGACCTG -3'

Sequencing Primer
(F):5'- AGCACAGCTCGGCAGTTC -3'
(R):5'- CATGGAGAGAGTAGGCGGGTTTG -3'
Posted On2015-06-20