Incidental Mutation 'R4287:Fpgt'
ID322055
Institutional Source Beutler Lab
Gene Symbol Fpgt
Ensembl Gene ENSMUSG00000053870
Gene Namefucose-1-phosphate guanylyltransferase
Synonyms1700016E03Rik
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location155084918-155093403 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 155091360 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029833] [ENSMUST00000066568] [ENSMUST00000192383] [ENSMUST00000194376]
Predicted Effect probably benign
Transcript: ENSMUST00000029833
SMART Domains Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182

DomainStartEndE-ValueType
SCOP:d1dcea3 36 155 3e-14 SMART
Blast:LRR 71 94 3e-6 BLAST
Blast:LRR 96 118 1e-5 BLAST
IQ 214 236 3.68e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066568
SMART Domains Protein: ENSMUSP00000068939
Gene: ENSMUSG00000053870

DomainStartEndE-ValueType
low complexity region 82 92 N/A INTRINSIC
Pfam:Fucokinase 106 524 1.8e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192247
Predicted Effect probably benign
Transcript: ENSMUST00000192383
SMART Domains Protein: ENSMUSP00000141372
Gene: ENSMUSG00000028182

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 9e-9 PFAM
Pfam:LRR_4 72 117 1.9e-8 PFAM
Pfam:LRR_1 73 94 5.1e-3 PFAM
IQ 214 236 3.68e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194095
Predicted Effect probably benign
Transcript: ENSMUST00000194376
SMART Domains Protein: ENSMUSP00000142127
Gene: ENSMUSG00000028182

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 7.2e-9 PFAM
Pfam:LRR_4 72 117 1.5e-8 PFAM
Pfam:LRR_1 73 94 4.2e-3 PFAM
IQ 214 236 3.68e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195505
Meta Mutation Damage Score 0.0452 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-fucose is a key sugar in glycoproteins and other complex carbohydrates since it may be involved in many of the functional roles of these macromolecules, such as in cell-cell recognition. The fucosyl donor for these fucosylated oligosaccharides is GDP-beta-L-fucose. There are two alternate pathways for the biosynthesis of GDP-fucose; the major pathway converts GDP-alpha-D-mannose to GDP-beta-L-fucose. The protein encoded by this gene participates in an alternate pathway that is present in certain mammalian tissues, such as liver and kidney, and appears to function as a salvage pathway to reutilize L-fucose arising from the turnover of glycoproteins and glycolipids. This pathway involves the phosphorylation of L-fucose to form beta-L-fucose-1-phosphate, and then condensation of the beta-L-fucose-1-phosphate with GTP by fucose-1-phosphate guanylyltransferase to form GDP-beta-L-fucose. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream TNNI3 interacting kinase (TNNI3K) gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Fpgt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fpgt APN 3 155091492 missense possibly damaging 0.92
IGL01412:Fpgt APN 3 155086722 missense probably benign 0.06
IGL01860:Fpgt APN 3 155086846 missense probably benign 0.38
IGL01977:Fpgt APN 3 155088018 missense probably damaging 0.99
IGL02136:Fpgt APN 3 155093352 missense probably benign
IGL02331:Fpgt APN 3 155087862 missense possibly damaging 0.90
IGL03106:Fpgt APN 3 155087122 missense probably damaging 1.00
PIT4431001:Fpgt UTSW 3 155086785 missense possibly damaging 0.95
R2072:Fpgt UTSW 3 155087874 missense probably damaging 1.00
R4607:Fpgt UTSW 3 155086696 nonsense probably null
R4608:Fpgt UTSW 3 155086696 nonsense probably null
R4873:Fpgt UTSW 3 155087913 missense probably damaging 1.00
R4875:Fpgt UTSW 3 155087913 missense probably damaging 1.00
R5973:Fpgt UTSW 3 155087403 missense probably damaging 1.00
R7134:Fpgt UTSW 3 155091483 missense probably damaging 1.00
R7300:Fpgt UTSW 3 155086975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCCAGTGTAAATTGTACTGAGGC -3'
(R):5'- GGATGTGGTTGCAATAACAGC -3'

Sequencing Primer
(F):5'- AAATAAGGTCTGGACTAGTTTCTCTG -3'
(R):5'- TGTGGTTGCAATAACAGCAGCTG -3'
Posted On2015-06-20