Incidental Mutation 'R4287:Anapc5'
ID322059
Institutional Source Beutler Lab
Gene Symbol Anapc5
Ensembl Gene ENSMUSG00000029472
Gene Nameanaphase-promoting complex subunit 5
Synonyms
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122787459-122821339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122800601 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 362 (V362A)
Ref Sequence ENSEMBL: ENSMUSP00000143053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086216] [ENSMUST00000196423] [ENSMUST00000196640] [ENSMUST00000197074] [ENSMUST00000197719] [ENSMUST00000199406] [ENSMUST00000200645]
Predicted Effect probably benign
Transcript: ENSMUST00000086216
AA Change: V370A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000083393
Gene: ENSMUSG00000029472
AA Change: V370A

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:ANAPC5 239 339 3.5e-34 PFAM
Pfam:ANAPC5 383 478 3.1e-3 PFAM
Blast:TPR 526 559 8e-12 BLAST
Blast:TPR 566 599 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196423
SMART Domains Protein: ENSMUSP00000143169
Gene: ENSMUSG00000029472

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 1.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196640
AA Change: V370A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142429
Gene: ENSMUSG00000029472
AA Change: V370A

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.8e-31 PFAM
Pfam:Apc5 383 478 5.1e0 PFAM
Blast:TPR 526 559 7e-12 BLAST
Blast:TPR 566 599 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196753
Predicted Effect probably benign
Transcript: ENSMUST00000197074
AA Change: V362A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143053
Gene: ENSMUSG00000029472
AA Change: V362A

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 3.9e-34 PFAM
Pfam:Apc5 375 470 4.1e-3 PFAM
Blast:TPR 518 551 7e-12 BLAST
Blast:TPR 558 591 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197554
Predicted Effect probably benign
Transcript: ENSMUST00000197719
SMART Domains Protein: ENSMUSP00000142579
Gene: ENSMUSG00000029472

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.7e-31 PFAM
Pfam:Apc5 370 465 5e0 PFAM
Blast:TPR 513 546 7e-12 BLAST
Blast:TPR 553 586 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199025
Predicted Effect probably benign
Transcript: ENSMUST00000199406
AA Change: V370A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142341
Gene: ENSMUSG00000029472
AA Change: V370A

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.1e-31 PFAM
Pfam:TPR_10 287 322 2.7e-1 PFAM
Pfam:Apc5 383 478 4.4e0 PFAM
Pfam:TPR_10 533 577 2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200415
Predicted Effect probably benign
Transcript: ENSMUST00000200645
SMART Domains Protein: ENSMUSP00000142922
Gene: ENSMUSG00000029472

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 3.9e-34 PFAM
Pfam:Apc5 370 465 4.1e-3 PFAM
Blast:TPR 513 546 7e-12 BLAST
Blast:TPR 553 586 5e-9 BLAST
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat-containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for the proper ubiquitination function of APC/C and for the interaction of APC/C with transcription coactivators. It also interacts with polyA binding protein and represses internal ribosome entry site-mediated translation. Multiple transcript variants encoding different isoforms have been found for this gene. These differences cause translation initiation at a downstream AUG and result in a shorter protein (isoform b), compared to isoform a. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Anapc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Anapc5 APN 5 122800613 missense possibly damaging 0.95
IGL03158:Anapc5 APN 5 122817897 missense probably benign
R0137:Anapc5 UTSW 5 122800632 missense probably damaging 1.00
R0319:Anapc5 UTSW 5 122818856 missense probably damaging 0.99
R0326:Anapc5 UTSW 5 122814604 missense probably benign 0.40
R0399:Anapc5 UTSW 5 122791753 missense probably damaging 0.99
R0633:Anapc5 UTSW 5 122800632 missense probably damaging 1.00
R1173:Anapc5 UTSW 5 122788418 missense possibly damaging 0.49
R1723:Anapc5 UTSW 5 122799343 missense probably damaging 0.96
R2018:Anapc5 UTSW 5 122800524 missense probably damaging 1.00
R2114:Anapc5 UTSW 5 122787938 missense probably benign 0.06
R4211:Anapc5 UTSW 5 122817905 missense probably benign
R4533:Anapc5 UTSW 5 122791735 missense possibly damaging 0.86
R4905:Anapc5 UTSW 5 122817910 missense probably benign 0.00
R5336:Anapc5 UTSW 5 122807337 missense probably damaging 1.00
R5499:Anapc5 UTSW 5 122788413 missense probably damaging 1.00
R5568:Anapc5 UTSW 5 122791925 utr 3 prime probably benign
R6481:Anapc5 UTSW 5 122800544 missense probably benign 0.27
R7461:Anapc5 UTSW 5 122818865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATTTCCATAGCGCCTG -3'
(R):5'- GCTGAGGTCAGGTCATAGGTTC -3'

Sequencing Primer
(F):5'- GCGCCTGCTTCTCTCTAAAGG -3'
(R):5'- CAGGTCATAGGTTCTTTAAGTAGAGC -3'
Posted On2015-06-20