Incidental Mutation 'R4287:Slc41a3'
ID322061
Institutional Source Beutler Lab
Gene Symbol Slc41a3
Ensembl Gene ENSMUSG00000030089
Gene Namesolute carrier family 41, member 3
Synonyms1010001P06Rik, SLC41A1-L2
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90604725-90646412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90640922 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 310 (H310L)
Ref Sequence ENSEMBL: ENSMUSP00000037473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032177] [ENSMUST00000044019]
Predicted Effect probably benign
Transcript: ENSMUST00000032177
AA Change: H284L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032177
Gene: ENSMUSG00000030089
AA Change: H284L

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Pfam:MgtE 80 214 3.4e-27 PFAM
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 258 277 N/A INTRINSIC
Pfam:MgtE 293 437 9.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044019
AA Change: H310L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037473
Gene: ENSMUSG00000030089
AA Change: H310L

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:MgtE 106 240 2.5e-27 PFAM
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 284 303 N/A INTRINSIC
Pfam:MgtE 319 463 7.2e-27 PFAM
Meta Mutation Damage Score 0.1388 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered magnesium ion homeostasis including hypomagnesemia. A subset of homozygotes develop severe unilateral hydronephrosis when fed a low magnesium diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Slc41a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Slc41a3 APN 6 90645714 missense probably damaging 1.00
IGL02583:Slc41a3 APN 6 90644171 missense probably damaging 0.99
PIT4378001:Slc41a3 UTSW 6 90640909 missense probably benign 0.36
R1076:Slc41a3 UTSW 6 90644160 missense probably benign
R1529:Slc41a3 UTSW 6 90644216 missense probably damaging 0.99
R1591:Slc41a3 UTSW 6 90633695 missense probably benign 0.02
R1985:Slc41a3 UTSW 6 90642228 missense probably damaging 1.00
R2133:Slc41a3 UTSW 6 90626381 missense probably damaging 0.99
R2308:Slc41a3 UTSW 6 90612120 missense possibly damaging 0.51
R2384:Slc41a3 UTSW 6 90626411 missense probably damaging 0.98
R2697:Slc41a3 UTSW 6 90642320 missense possibly damaging 0.81
R3237:Slc41a3 UTSW 6 90636865 missense probably benign 0.10
R4394:Slc41a3 UTSW 6 90635330 missense probably damaging 1.00
R5039:Slc41a3 UTSW 6 90626417 missense probably damaging 1.00
R5195:Slc41a3 UTSW 6 90633671 missense probably damaging 1.00
R5293:Slc41a3 UTSW 6 90626444 missense probably damaging 0.99
R5338:Slc41a3 UTSW 6 90612171 missense possibly damaging 0.93
R5608:Slc41a3 UTSW 6 90640907 missense probably benign 0.06
R5681:Slc41a3 UTSW 6 90640946 missense probably damaging 0.99
R5783:Slc41a3 UTSW 6 90619542 missense probably benign 0.06
R6648:Slc41a3 UTSW 6 90619508 missense probably damaging 0.99
X0025:Slc41a3 UTSW 6 90635322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATAGCTACTGGTGGGAC -3'
(R):5'- TCAAGCCTAACAGAACCTGTAG -3'

Sequencing Primer
(F):5'- CACCATGTTCTCTGGTAGGAAACTG -3'
(R):5'- CCTAACAGAACCTGTAGGCTGTG -3'
Posted On2015-06-20