Incidental Mutation 'R4287:Unc5d'
ID322067
Institutional Source Beutler Lab
Gene Symbol Unc5d
Ensembl Gene ENSMUSG00000063626
Gene Nameunc-5 netrin receptor D
SynonymsUnc5h4, D930029E11Rik
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location28646717-29219636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28719796 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 432 (Y432F)
Ref Sequence ENSEMBL: ENSMUSP00000147306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168630] [ENSMUST00000209401] [ENSMUST00000210298] [ENSMUST00000210785] [ENSMUST00000211448]
Predicted Effect probably benign
Transcript: ENSMUST00000168630
AA Change: Y504F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128521
Gene: ENSMUSG00000063626
AA Change: Y504F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1cs6a2 52 146 5e-3 SMART
IGc2 169 236 2.66e-8 SMART
TSP1 253 304 2.29e-13 SMART
TSP1 309 358 6.33e-7 SMART
transmembrane domain 383 405 N/A INTRINSIC
Pfam:ZU5 545 642 1.6e-33 PFAM
DEATH 850 941 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209401
AA Change: Y430F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000210298
AA Change: Y443F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000210785
AA Change: Y486F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000211448
AA Change: Y432F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice exhibit impaired induced growth cone collapse response and accelerated radial migration of cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Unc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Unc5d APN 8 28719826 missense probably damaging 0.97
IGL00687:Unc5d APN 8 28715813 splice site probably benign
IGL00970:Unc5d APN 8 28696428 missense probably benign 0.15
IGL01992:Unc5d APN 8 28652791 missense probably damaging 0.98
IGL02024:Unc5d APN 8 28652827 missense probably benign 0.08
IGL02080:Unc5d APN 8 28891288 splice site probably null
IGL02902:Unc5d APN 8 28875606 missense probably damaging 1.00
IGL02982:Unc5d APN 8 28652853 missense probably damaging 1.00
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0761:Unc5d UTSW 8 28696532 intron probably null
R0941:Unc5d UTSW 8 28759027 missense possibly damaging 0.85
R1086:Unc5d UTSW 8 28875630 missense possibly damaging 0.87
R1625:Unc5d UTSW 8 28683206 missense probably damaging 1.00
R1635:Unc5d UTSW 8 28760749 missense probably benign 0.14
R1682:Unc5d UTSW 8 28759081 missense probably damaging 1.00
R1698:Unc5d UTSW 8 28696478 missense probably damaging 0.99
R2015:Unc5d UTSW 8 28758979 missense probably damaging 1.00
R2132:Unc5d UTSW 8 28875529 missense possibly damaging 0.50
R2174:Unc5d UTSW 8 28694540 missense probably damaging 0.99
R2210:Unc5d UTSW 8 28761797 missense probably damaging 0.97
R3684:Unc5d UTSW 8 28694592 missense probably damaging 1.00
R3734:Unc5d UTSW 8 28761798 missense probably benign 0.02
R4093:Unc5d UTSW 8 28844837 missense possibly damaging 0.87
R4888:Unc5d UTSW 8 28666899 missense probably benign 0.02
R5000:Unc5d UTSW 8 28715747 missense possibly damaging 0.90
R5060:Unc5d UTSW 8 28719695 missense probably benign 0.00
R5076:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
R5696:Unc5d UTSW 8 28666842 missense probably benign 0.06
R6024:Unc5d UTSW 8 28875511 missense possibly damaging 0.96
R6077:Unc5d UTSW 8 28675307 missense possibly damaging 0.94
R6259:Unc5d UTSW 8 28666792 missense probably benign 0.00
R6387:Unc5d UTSW 8 28875526 nonsense probably null
R7038:Unc5d UTSW 8 28715721 critical splice donor site probably null
X0058:Unc5d UTSW 8 28760730 missense probably benign 0.12
X0060:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTTCGCTGATCACTTCCAAATG -3'
(R):5'- AGCCAGATCTGACTGTGAGC -3'

Sequencing Primer
(F):5'- CACCTGTATTTGGCATTACTAAGCG -3'
(R):5'- ATCTGACTGTGAGCCGGACATAC -3'
Posted On2015-06-20