Incidental Mutation 'R4287:Olfr186'
ID322076
Institutional Source Beutler Lab
Gene Symbol Olfr186
Ensembl Gene ENSMUSG00000047960
Gene Nameolfactory receptor 186
SynonymsGA_x54KRFPKG5P-55257214-55256285, MOR183-9
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59025797-59030291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59027613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 98 (M98K)
Ref Sequence ENSEMBL: ENSMUSP00000150366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062380] [ENSMUST00000206463] [ENSMUST00000216415]
Predicted Effect probably benign
Transcript: ENSMUST00000062380
AA Change: M98K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000056448
Gene: ENSMUSG00000047960
AA Change: M98K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-49 PFAM
Pfam:7tm_1 41 290 7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205894
Predicted Effect probably benign
Transcript: ENSMUST00000206463
AA Change: M98K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000216415
AA Change: M98K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Olfr186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr186 APN 16 59027853 missense probably benign 0.00
IGL00969:Olfr186 APN 16 59027631 missense possibly damaging 0.48
IGL01102:Olfr186 APN 16 59027829 missense probably benign 0.03
IGL01348:Olfr186 APN 16 59027794 missense probably damaging 1.00
IGL01399:Olfr186 APN 16 59027266 missense probably benign 0.05
IGL02088:Olfr186 APN 16 59027052 missense probably damaging 1.00
R0047:Olfr186 UTSW 16 59027224 missense probably benign 0.00
R0479:Olfr186 UTSW 16 59027128 missense possibly damaging 0.64
R0866:Olfr186 UTSW 16 59027428 missense probably benign
R0926:Olfr186 UTSW 16 59027688 missense possibly damaging 0.80
R1760:Olfr186 UTSW 16 59026987 missense probably benign 0.01
R1955:Olfr186 UTSW 16 59027411 missense probably damaging 0.99
R2085:Olfr186 UTSW 16 59027869 missense probably benign 0.02
R2118:Olfr186 UTSW 16 59027815 missense possibly damaging 0.78
R4156:Olfr186 UTSW 16 59027568 missense probably damaging 1.00
R4783:Olfr186 UTSW 16 59027897 missense probably benign
R4885:Olfr186 UTSW 16 59027155 missense probably damaging 1.00
R4947:Olfr186 UTSW 16 59027445 missense probably damaging 0.98
R4965:Olfr186 UTSW 16 59027333 missense probably damaging 1.00
R6314:Olfr186 UTSW 16 59027457 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GAAGAAAGCCACCTATGAATACTG -3'
(R):5'- ATCATCAAGGGCTGCAGGTG -3'

Sequencing Primer
(F):5'- CCTATGAATACTGAAACTAGTAGGCG -3'
(R):5'- ATATCTCATCACTGTTGTGGGGAAC -3'
Posted On2015-06-20