Mutagenetix > Incidental Mutations

Incidental Mutation 'R4288:Stard13'

322101

Institutional Source

Beutler Lab

Gene Symbol

Stard13

Ensembl Gene

ENSMUSG00000016128

Gene Name

StAR-related lipid transfer (START) domain containing 13

Synonyms

GT650, DLC2

MMRRC Submission

041653-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4288 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151037510-151233836 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 151045177 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 994 (T994M)

Ref Sequence

ENSEMBL: ENSMUSP00000106109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000202111]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062015
AA Change: T1013M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: T1013M

Domain	Start	End	E-Value	Type
Pfam:SAM_2	59	120	2.6e-6	PFAM
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	693	884	2.37e-50	SMART
START	927	1129	2.08e-40	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110483
AA Change: T994M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: T994M

Domain	Start	End	E-Value	Type
PDB:2JW2\|A	50	120	1e-37	PDB
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	674	865	2.37e-50	SMART
START	908	1110	2.08e-40	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202111
AA Change: T876M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: T876M

Domain	Start	End	E-Value	Type
low complexity region	79	98	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
RhoGAP	556	747	1.4e-52	SMART
START	790	992	1.4e-42	SMART

Meta Mutation Damage Score

0.0288

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	G	A	1: 127,738,572	V27M	probably damaging	Het
Acsl6	A	G	11: 54,337,086	T311A	probably benign	Het
Adss	G	A	1: 177,776,512	R176W	probably damaging	Het
Akr7a5	T	C	4: 139,314,104	V108A	probably benign	Het
Atp13a1	A	G	8: 69,794,078	D209G	possibly damaging	Het
Cdcp1	T	A	9: 123,183,628	I285F	probably damaging	Het
Ctnna2	C	T	6: 77,605,221	R339Q	probably damaging	Het
D3Ertd254e	A	G	3: 36,159,598	N27S	possibly damaging	Het
E130308A19Rik	G	A	4: 59,690,308	M47I	probably benign	Het
Exosc9	C	T	3: 36,563,216	T373I	probably benign	Het
Fam71e2	T	A	7: 4,770,723	N58Y	possibly damaging	Het
Fat4	T	A	3: 38,891,763	S1602T	probably damaging	Het
Fbn2	T	C	18: 58,035,339	I2309V	probably damaging	Het
Fbxo42	T	C	4: 141,167,896	Y57H	probably damaging	Het
Fcrl5	A	G	3: 87,442,224	D102G	probably benign	Het
Gpr37l1	A	G	1: 135,161,184	V381A	probably damaging	Het
Hc	G	T	2: 35,030,402	A644E	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Impad1	A	C	4: 4,778,231	V169G	probably damaging	Het
Lpar5	T	C	6: 125,081,864	Y183H	probably benign	Het
Ltn1	T	A	16: 87,397,988	N1341I	possibly damaging	Het
Mms19	A	G	19: 41,945,553	L938P	probably damaging	Het
Neb	T	G	2: 52,259,300	E2516D	probably damaging	Het
Parp4	T	C	14: 56,607,494	V614A	probably damaging	Het
Pogk	A	G	1: 166,403,506	L84P	probably damaging	Het
Stk4	A	G	2: 164,099,712	S283G	probably benign	Het
Ttn	T	C	2: 76,810,398	T13669A	probably benign	Het
Vil1	A	G	1: 74,418,525	T106A	probably benign	Het
Vmn1r18	A	G	6: 57,390,407	L54P	probably damaging	Het
Vmn1r227	G	T	17: 20,735,830		noncoding transcript	Het
Zfp748	T	A	13: 67,541,083	H686L	probably damaging	Het
Zyg11a	C	T	4: 108,184,469	S658N	probably damaging	Het

Other mutations in Stard13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Stard13	APN	5	151042239	missense	probably damaging	1.00
IGL01362:Stard13	APN	5	151189952	missense	probably benign	0.05
IGL01588:Stard13	APN	5	151045237	missense	probably damaging	1.00
IGL01947:Stard13	APN	5	151062844	missense	probably damaging	1.00
IGL02294:Stard13	APN	5	151063115	missense	probably benign	0.19
IGL02713:Stard13	APN	5	151042186	nonsense	probably null
IGL02746:Stard13	APN	5	151046857	splice site	probably benign
IGL02827:Stard13	APN	5	151063126	missense	probably benign	0.07
R0498:Stard13	UTSW	5	151052477	missense	probably damaging	1.00
R1427:Stard13	UTSW	5	151045991	missense	probably damaging	0.99
R1785:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R1857:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R1858:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R2130:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2131:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2132:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2133:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2258:Stard13	UTSW	5	151039731	missense	probably damaging	1.00
R3435:Stard13	UTSW	5	151042179	missense	probably damaging	1.00
R4080:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4081:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4082:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4233:Stard13	UTSW	5	151062699	missense	probably benign	0.00
R4303:Stard13	UTSW	5	151062869	missense	possibly damaging	0.82
R4659:Stard13	UTSW	5	151062788	missense	probably benign	0.01
R4695:Stard13	UTSW	5	151060815	missense	probably benign	0.08
R4910:Stard13	UTSW	5	151062527	missense	probably benign
R5135:Stard13	UTSW	5	151062767	nonsense	probably null
R5338:Stard13	UTSW	5	151059598	missense	probably damaging	1.00
R5399:Stard13	UTSW	5	151047801	nonsense	probably null
R5546:Stard13	UTSW	5	151045901	missense	probably benign	0.03
R5685:Stard13	UTSW	5	151063127	missense	possibly damaging	0.78
R5771:Stard13	UTSW	5	151190011	missense	probably damaging	1.00
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6141:Stard13	UTSW	5	151042242	missense	probably damaging	1.00
R6171:Stard13	UTSW	5	151092762	missense	probably damaging	1.00
R6296:Stard13	UTSW	5	151062673	missense	probably damaging	1.00
R6326:Stard13	UTSW	5	151046919	missense	possibly damaging	0.95
R6508:Stard13	UTSW	5	151063289	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GTCAGGCATAAATAAGGCAACATC -3'
(R):5'- AGTGATGGTTTGGAATGCCC -3'

Sequencing Primer
(F):5'- CAACATCAGAGAGGATTGGGC -3'
(R):5'- CCCAGCATAGGAGGTAGGTCTG -3'

Posted On

2015-06-20