Incidental Mutation 'R4288:Stard13'
ID322101
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission 041653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4288 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 151045177 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 994 (T994M)
Ref Sequence ENSEMBL: ENSMUSP00000106109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000202111]
Predicted Effect probably damaging
Transcript: ENSMUST00000062015
AA Change: T1013M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: T1013M

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110483
AA Change: T994M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: T994M

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202111
AA Change: T876M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: T876M

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd G A 1: 127,738,572 V27M probably damaging Het
Acsl6 A G 11: 54,337,086 T311A probably benign Het
Adss G A 1: 177,776,512 R176W probably damaging Het
Akr7a5 T C 4: 139,314,104 V108A probably benign Het
Atp13a1 A G 8: 69,794,078 D209G possibly damaging Het
Cdcp1 T A 9: 123,183,628 I285F probably damaging Het
Ctnna2 C T 6: 77,605,221 R339Q probably damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
E130308A19Rik G A 4: 59,690,308 M47I probably benign Het
Exosc9 C T 3: 36,563,216 T373I probably benign Het
Fam71e2 T A 7: 4,770,723 N58Y possibly damaging Het
Fat4 T A 3: 38,891,763 S1602T probably damaging Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fbxo42 T C 4: 141,167,896 Y57H probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Gpr37l1 A G 1: 135,161,184 V381A probably damaging Het
Hc G T 2: 35,030,402 A644E probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Impad1 A C 4: 4,778,231 V169G probably damaging Het
Lpar5 T C 6: 125,081,864 Y183H probably benign Het
Ltn1 T A 16: 87,397,988 N1341I possibly damaging Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Neb T G 2: 52,259,300 E2516D probably damaging Het
Parp4 T C 14: 56,607,494 V614A probably damaging Het
Pogk A G 1: 166,403,506 L84P probably damaging Het
Stk4 A G 2: 164,099,712 S283G probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r18 A G 6: 57,390,407 L54P probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Zyg11a C T 4: 108,184,469 S658N probably damaging Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTCAGGCATAAATAAGGCAACATC -3'
(R):5'- AGTGATGGTTTGGAATGCCC -3'

Sequencing Primer
(F):5'- CAACATCAGAGAGGATTGGGC -3'
(R):5'- CCCAGCATAGGAGGTAGGTCTG -3'
Posted On2015-06-20