Mutagenetix > Incidental Mutation

Incidental Mutation 'R4270:Ctsh'

322129

Institutional Source

Beutler Lab

Gene Symbol

Ctsh

Ensembl Gene

ENSMUSG00000032359

Gene Name

cathepsin H

Synonyms

Cat H

MMRRC Submission

041075-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4270 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89936320-89958148 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89943651 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 92 (H92R)

Ref Sequence

ENSEMBL: ENSMUSP00000117599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000132718] [ENSMUST00000143172] [ENSMUST00000185459]

AlphaFold

P49935

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034915
AA Change: H66R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359
AA Change: H66R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Inhibitor_I29	33	88	7.24e-17	SMART
Pept_C1	114	330	7.46e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127842

Predicted Effect

probably damaging
Transcript: ENSMUST00000132718
AA Change: H92R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359
AA Change: H92R

Domain	Start	End	E-Value	Type
Inhibitor_I29	59	114	7.24e-17	SMART
Pfam:Peptidase_C1	140	198	4.4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142750

Predicted Effect

probably benign
Transcript: ENSMUST00000143172

SMART Domains

Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1cs8a_	62	118	3e-6	SMART
Blast:Pept_C1	63	119	3e-24	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185459
AA Change: H63R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359
AA Change: H63R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Inhibitor_I29	30	85	5.3e-21	SMART
Pept_C1	85	291	9.4e-87	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190338

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ash1l	T	A	3: 88,889,347 (GRCm39)	C409S	probably benign	Het
Aspg	T	C	12: 112,087,629 (GRCm39)	S327P	probably damaging	Het
Ccdc88c	G	T	12: 100,913,478 (GRCm39)	Q516K	probably damaging	Het
Cdh11	T	A	8: 103,391,258 (GRCm39)	D326V	possibly damaging	Het
Ctsa	G	T	2: 164,677,222 (GRCm39)	M210I	probably benign	Het
Fanca	A	G	8: 123,995,533 (GRCm39)	L117P	probably damaging	Het
Foxo1	A	G	3: 52,252,826 (GRCm39)	T330A	probably benign	Het
Ighv1-43	C	G	12: 114,909,772 (GRCm39)	G50A	probably benign	Het
Igkv9-120	G	T	6: 68,027,351 (GRCm39)	R88S	possibly damaging	Het
Kif26a	C	T	12: 112,139,848 (GRCm39)	S460F	probably damaging	Het
Mxra8	C	A	4: 155,925,594 (GRCm39)	P98Q	probably damaging	Het
Nbr1	T	C	11: 101,458,048 (GRCm39)	Y276H	possibly damaging	Het
Nckap1l	T	C	15: 103,381,549 (GRCm39)	L430P	possibly damaging	Het
Nubp2	A	T	17: 25,104,567 (GRCm39)	C58S	probably damaging	Het
Or8c10	A	G	9: 38,278,997 (GRCm39)	N52D	probably damaging	Het
Pramel51	A	T	12: 88,145,053 (GRCm39)	I91K	probably damaging	Het
Rbms3	T	A	9: 116,885,816 (GRCm39)	N94I	probably damaging	Het
Rimbp2	T	G	5: 128,896,841 (GRCm39)	N23T	probably benign	Het
Rwdd3	T	C	3: 120,952,550 (GRCm39)	D147G	probably damaging	Het
Slc30a5	T	G	13: 100,965,521 (GRCm39)	R29S	probably benign	Het
Syt10	C	A	15: 89,675,095 (GRCm39)	R417L	probably benign	Het
Trim58	T	C	11: 58,542,093 (GRCm39)	V351A	probably damaging	Het
Trpc3	G	T	3: 36,717,074 (GRCm39)	Y321*	probably null	Het
Vmn2r107	G	T	17: 20,576,041 (GRCm39)	V124F	probably benign	Het
Xkr7	T	C	2: 152,896,235 (GRCm39)	V363A	possibly damaging	Het
Zfp597	A	T	16: 3,689,954 (GRCm39)	M1K	probably null	Het

Other mutations in Ctsh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Ctsh	APN	9	89,946,291 (GRCm39)	missense	probably damaging	1.00
IGL01875:Ctsh	APN	9	89,946,260 (GRCm39)	missense	probably damaging	1.00
IGL02008:Ctsh	APN	9	89,943,600 (GRCm39)	missense	probably damaging	1.00
R0336:Ctsh	UTSW	9	89,957,791 (GRCm39)	missense	probably damaging	1.00
R0632:Ctsh	UTSW	9	89,943,635 (GRCm39)	missense	possibly damaging	0.82
R1488:Ctsh	UTSW	9	89,953,944 (GRCm39)	missense	possibly damaging	0.89
R1847:Ctsh	UTSW	9	89,943,618 (GRCm39)	missense	probably benign	0.04
R3613:Ctsh	UTSW	9	89,957,763 (GRCm39)	missense	probably damaging	1.00
R4860:Ctsh	UTSW	9	89,936,601 (GRCm39)	missense	probably benign	0.01
R5187:Ctsh	UTSW	9	89,936,643 (GRCm39)	missense	probably damaging	1.00
R5469:Ctsh	UTSW	9	89,942,564 (GRCm39)	critical splice donor site	probably null
R5900:Ctsh	UTSW	9	89,946,621 (GRCm39)	missense	probably damaging	1.00
R5937:Ctsh	UTSW	9	89,943,509 (GRCm39)	missense	probably benign
R6303:Ctsh	UTSW	9	89,944,796 (GRCm39)	missense	possibly damaging	0.83
R6657:Ctsh	UTSW	9	89,942,555 (GRCm39)	missense	probably benign	0.30
R6905:Ctsh	UTSW	9	89,944,819 (GRCm39)	missense	probably damaging	1.00
R6985:Ctsh	UTSW	9	89,936,657 (GRCm39)	missense	possibly damaging	0.90
R7171:Ctsh	UTSW	9	89,949,154 (GRCm39)	missense	probably benign
R7342:Ctsh	UTSW	9	89,957,040 (GRCm39)	missense	probably benign
R7819:Ctsh	UTSW	9	89,942,556 (GRCm39)	missense	possibly damaging	0.71
R7884:Ctsh	UTSW	9	89,943,476 (GRCm39)	missense	probably benign
R8099:Ctsh	UTSW	9	89,946,300 (GRCm39)	missense	probably damaging	1.00
R8294:Ctsh	UTSW	9	89,950,489 (GRCm39)	missense	possibly damaging	0.74
R9195:Ctsh	UTSW	9	89,944,815 (GRCm39)	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGTGGCAGAATGAAAATCCCC -3'
(R):5'- AGACATCCCTGATTCTGAGTCTC -3'

Sequencing Primer
(F):5'- ATCCCCATGGACTGGTGATTCAG -3'
(R):5'- GAGTCTCTGCTCTCTATGCCTGTTAG -3'

Posted On

2015-06-20