Incidental Mutation 'R4270:Nckap1l'
ID322140
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 041075-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R4270 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103473122 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 430 (L430P)
Ref Sequence ENSEMBL: ENSMUSP00000035400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047405
AA Change: L430P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: L430P

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Ctsa G T 2: 164,835,302 M210I probably benign Het
Ctsh A G 9: 90,061,598 H92R probably damaging Het
Fanca A G 8: 123,268,794 L117P probably damaging Het
Foxo1 A G 3: 52,345,405 T330A probably benign Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Ighv1-43 C G 12: 114,946,152 G50A probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Mxra8 C A 4: 155,841,137 P98Q probably damaging Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nubp2 A T 17: 24,885,593 C58S probably damaging Het
Olfr250 A G 9: 38,367,701 N52D probably damaging Het
Rbms3 T A 9: 117,056,748 N94I probably damaging Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Rwdd3 T C 3: 121,158,901 D147G probably damaging Het
Slc30a5 T G 13: 100,829,013 R29S probably benign Het
Syt10 C A 15: 89,790,892 R417L probably benign Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Trpc3 G T 3: 36,662,925 Y321* probably null Het
Vmn2r107 G T 17: 20,355,779 V124F probably benign Het
Xkr7 T C 2: 153,054,315 V363A possibly damaging Het
Zfp597 A T 16: 3,872,090 M1K probably null Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense probably null
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0137:Nckap1l UTSW 15 103481964 missense probably benign 0.01
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0412:Nckap1l UTSW 15 103464652 missense probably benign 0.01
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1245:Nckap1l UTSW 15 103455925 missense probably damaging 1.00
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAGGTGTCACATGATCTGGG -3'
(R):5'- TTGCTTAGAGGGAAGAAATCTGC -3'

Sequencing Primer
(F):5'- CCTTGTCTTTACAGGAGC -3'
(R):5'- GGAAGAAATCTGCTGAGACTATTC -3'
Posted On2015-06-20