Incidental Mutation 'R4271:C1galt1'
ID322159
Institutional Source Beutler Lab
Gene Symbol C1galt1
Ensembl Gene ENSMUSG00000042460
Gene Namecore 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
SynonymsT-synthase, core 1 beta3-Gal-T, 2210410E06Rik
MMRRC Submission 041076-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location7844842-7875687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7866607 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 151 (F151S)
Ref Sequence ENSEMBL: ENSMUSP00000047931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040159]
Predicted Effect probably damaging
Transcript: ENSMUST00000040159
AA Change: F151S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047931
Gene: ENSMUSG00000042460
AA Change: F151S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 83 283 3e-18 PFAM
Pfam:Galactosyl_T 108 258 6.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203898
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Embryos homozygous for a null allele show impaired angiogenesis, chaotic microvascular networks in brain, and fatal hemorrhage by E14. Eggs homozygous for another null allele show a slightly thinner zona pellucida. Mice homozygous for an ENU-induced allele develop thrombocytopenia and renal disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gm1110 A T 9: 26,895,648 probably null Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Oacyl T A 18: 65,737,967 L340Q probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Olfr733 A T 14: 50,298,451 I286N probably damaging Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Polr1a G A 6: 71,953,022 E898K probably benign Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Srpk2 T A 5: 23,548,515 H80L possibly damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Zeb1 C A 18: 5,758,985 Q148K probably damaging Het
Other mutations in C1galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:C1galt1 APN 6 7866475 missense probably damaging 0.98
PIT4378001:C1galt1 UTSW 6 7863944 missense probably benign 0.01
R0086:C1galt1 UTSW 6 7867051 splice site probably benign
R0540:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R0567:C1galt1 UTSW 6 7866874 missense probably damaging 1.00
R0607:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R1519:C1galt1 UTSW 6 7866402 missense probably damaging 0.99
R1712:C1galt1 UTSW 6 7871217 missense probably benign
R2989:C1galt1 UTSW 6 7866622 missense possibly damaging 0.50
R3035:C1galt1 UTSW 6 7866762 missense probably benign 0.06
R4749:C1galt1 UTSW 6 7866379 missense probably benign 0.42
R5029:C1galt1 UTSW 6 7863931 missense possibly damaging 0.95
R5393:C1galt1 UTSW 6 7864143 critical splice donor site probably null
R5448:C1galt1 UTSW 6 7866658 missense possibly damaging 0.95
R7055:C1galt1 UTSW 6 7866585 missense probably damaging 1.00
R7319:C1galt1 UTSW 6 7871150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATGAGAACATAGACGTTGCTG -3'
(R):5'- ATGTATCCCTGCTTCACATAGG -3'

Sequencing Primer
(F):5'- GACGTTGCTGAGAACCTCTATCAG -3'
(R):5'- GGGCTTAAATCTTCGCCCAAAG -3'
Posted On2015-06-20