Incidental Mutation 'R4271:Zeb1'
ID322192
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Namezinc finger E-box binding homeobox 1
Synonyms3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1
MMRRC Submission 041076-MU
Accession Numbers

Genbank: NM_011546; MGI: 1344313

Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location5591860-5775467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5758985 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 148 (Q148K)
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000160910] [ENSMUST00000175925]
Predicted Effect probably damaging
Transcript: ENSMUST00000025081
AA Change: Q148K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: Q148K

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159390
AA Change: Q94K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238
AA Change: Q94K

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 96 119 3.16e-3 SMART
ZnF_C2H2 126 148 3.21e-4 SMART
ZnF_C2H2 166 188 4.87e-4 SMART
ZnF_C2H2 194 214 1.86e1 SMART
low complexity region 234 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160910
AA Change: Q131K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124815
Gene: ENSMUSG00000024238
AA Change: Q131K

DomainStartEndE-ValueType
ZnF_C2H2 133 153 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162892
SMART Domains Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 94 117 1.3e-5 SMART
ZnF_C2H2 124 146 1.3e-6 SMART
ZnF_C2H2 164 186 2e-6 SMART
ZnF_C2H2 192 212 7.8e-2 SMART
low complexity region 232 248 N/A INTRINSIC
low complexity region 476 499 N/A INTRINSIC
HOX 503 565 3.9e-5 SMART
low complexity region 674 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175925
SMART Domains Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 130 153 3.16e-3 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 200 222 4.87e-4 SMART
ZnF_C2H2 228 248 1.86e1 SMART
low complexity region 268 284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177030
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177070
SMART Domains Protein: ENSMUSP00000135543
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 130 153 3.16e-3 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1galt1 T C 6: 7,866,607 F151S probably damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gm1110 A T 9: 26,895,648 probably null Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Oacyl T A 18: 65,737,967 L340Q probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Olfr733 A T 14: 50,298,451 I286N probably damaging Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Polr1a G A 6: 71,953,022 E898K probably benign Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Srpk2 T A 5: 23,548,515 H80L possibly damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5767774 missense probably benign 0.00
IGL01139:Zeb1 APN 18 5705061 missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5767906 missense probably damaging 1.00
IGL01444:Zeb1 APN 18 5767138 missense probably benign
IGL01806:Zeb1 APN 18 5767867 missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5759037 nonsense probably null
IGL02059:Zeb1 APN 18 5766892 missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5767150 missense probably benign 0.03
IGL03153:Zeb1 APN 18 5770511 missense probably damaging 1.00
cellophane UTSW 18 5770554 nonsense probably null
serpens UTSW 18 5772455 missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5767076 missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5766808 missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5772455 missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5759123 nonsense probably null
R0646:Zeb1 UTSW 18 5759027 missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5767138 missense probably benign
R1251:Zeb1 UTSW 18 5705089 missense probably damaging 1.00
R1257:Zeb1 UTSW 18 5772699 missense possibly damaging 0.53
R1501:Zeb1 UTSW 18 5761399 missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5767450 missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5766298 nonsense probably null
R1815:Zeb1 UTSW 18 5767898 missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5766458 missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5767681 missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5772859 small insertion probably benign
R3888:Zeb1 UTSW 18 5748743 missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5767799 missense probably benign 0.06
R3952:Zeb1 UTSW 18 5772716 missense probably benign 0.17
R4512:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5766775 missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5767286 missense probably damaging 1.00
R5839:Zeb1 UTSW 18 5767507 missense probably benign
R5913:Zeb1 UTSW 18 5766765 missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5766962 missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5772743 missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5770498 missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5591917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTCTCATGCATACCTGGAGG -3'
(R):5'- AAGCTTCCCTGAGTCACCAG -3'

Sequencing Primer
(F):5'- GTGTCATCCACCCTTCATCTTTGG -3'
(R):5'- TGAGTCACCAGGTGCCCATC -3'
Posted On2015-06-20