Incidental Mutation 'R4273:Grid2'
ID322271
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission 041645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4273 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63909045 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 142 (Y142H)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: Y142H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: Y142H

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159561
SMART Domains Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161105
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,598 probably null Het
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Akap8l T A 17: 32,321,931 K533* probably null Het
Appbp2 T C 11: 85,234,676 Y45C probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arhgap31 T C 16: 38,602,335 E1123G possibly damaging Het
Atp2c1 G T 9: 105,435,140 N493K probably benign Het
Bcr T C 10: 75,125,111 I458T probably damaging Het
Brd4 G A 17: 32,214,782 T468I probably benign Het
Cdh23 T A 10: 60,311,161 D2774V possibly damaging Het
Cfdp1 T C 8: 111,768,785 Y267C probably damaging Het
Chd6 C A 2: 160,961,291 A2156S probably benign Het
Dazap2 C A 15: 100,618,090 P100T probably damaging Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dst C T 1: 34,192,340 R3183C possibly damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3l T C 8: 105,289,961 *740W probably null Het
Exoc5 A T 14: 49,015,480 C625* probably null Het
Fam98b A T 2: 117,260,231 N137Y possibly damaging Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fcer2a C A 8: 3,682,848 V319L possibly damaging Het
Fer1l6 T C 15: 58,627,522 V1247A probably benign Het
Fmo4 A G 1: 162,805,179 V201A probably damaging Het
Fras1 G A 5: 96,614,904 G755D probably benign Het
Gm13078 A T 4: 143,726,846 K175* probably null Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ibtk T C 9: 85,726,731 Q376R probably damaging Het
Impdh2 T C 9: 108,564,956 M414T probably damaging Het
Itm2c A G 1: 85,907,029 T160A probably damaging Het
Kcna2 T A 3: 107,105,193 D363E probably benign Het
Lama2 C T 10: 27,347,054 C412Y probably damaging Het
Lims2 C G 18: 31,956,337 T151S probably benign Het
Mier1 T C 4: 103,162,431 S423P possibly damaging Het
Mrgpra3 A T 7: 47,589,432 W249R probably benign Het
Mtor A G 4: 148,550,152 H2410R probably benign Het
Mvp C T 7: 126,989,703 A631T probably benign Het
Nepro T C 16: 44,735,829 V450A possibly damaging Het
Ngrn T C 7: 80,264,521 V140A probably damaging Het
Nobox T C 6: 43,306,008 E231G probably benign Het
Olfr129 A T 17: 38,055,272 I98N probably damaging Het
P3h2 T A 16: 26,105,221 I155F probably benign Het
Pcdha3 C T 18: 36,948,091 R629C probably damaging Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rttn T C 18: 89,091,896 I1675T probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Slc35f4 G T 14: 49,304,301 T182N possibly damaging Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sox9 T C 11: 112,785,154 S390P possibly damaging Het
Tango2 T C 16: 18,302,790 probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tek G A 4: 94,829,970 G524R probably damaging Het
Tmem260 A T 14: 48,505,304 Y532F probably benign Het
Tsks C A 7: 44,957,929 L559I probably damaging Het
Unc79 C A 12: 103,122,353 L1702I probably damaging Het
Vmn1r14 T A 6: 57,234,148 I237N probably damaging Het
Vmn2r17 G A 5: 109,452,966 C710Y probably benign Het
Zfp119b G T 17: 55,938,926 T420K possibly damaging Het
Zfp202 C T 9: 40,207,494 R68* probably null Het
Zfp229 T A 17: 21,746,821 S677R probably benign Het
Zfp462 C T 4: 55,008,411 H126Y probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zfp616 T A 11: 74,083,700 M265K probably benign Het
Zfyve9 A T 4: 108,680,976 I1031N probably damaging Het
Zmynd11 T C 13: 9,697,690 Y203C probably damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAACCAGGGCATCTTGGC -3'
(R):5'- TGTCTTACACACTCCAACAGG -3'

Sequencing Primer
(F):5'- GCCTTGGTCAGCTCCATTGG -3'
(R):5'- CACTCCAACAGGTATTTATGTTTACG -3'
Posted On2015-06-20