Incidental Mutation 'R4289:Pappa'
ID322321
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65155863 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 218 (A218V)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably benign
Transcript: ENSMUST00000084501
AA Change: A218V

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: A218V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGTGATCAAGGCAACAG -3'
(R):5'- ATTGCTGAATTCCACCTGGG -3'

Sequencing Primer
(F):5'- GCAACAGAGATCCACGCTACTTTTTC -3'
(R):5'- TGAATTCCACCTGGGGGCTG -3'
Posted On2015-06-20