Incidental Mutation 'R4289:Gm5581'
ID322330
Institutional Source Beutler Lab
Gene Symbol Gm5581
Ensembl Gene ENSMUSG00000061969
Gene Namepredicted gene 5581
Synonyms
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131166365-131182379 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 131167556 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072940
SMART Domains Protein: ENSMUSP00000072710
Gene: ENSMUSG00000061969

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 285 302 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
PDB:1MEY|G 422 507 4e-15 PDB
Blast:HNHc 445 504 4e-6 BLAST
ZnF_C2H2 509 531 9.73e-4 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 1.98e-4 SMART
ZnF_C2H2 593 615 1.52e-5 SMART
ZnF_C2H2 621 643 9.73e-4 SMART
ZnF_C2H2 649 671 9.36e-6 SMART
ZnF_C2H2 677 699 3.49e-5 SMART
ZnF_C2H2 705 727 9.88e-5 SMART
ZnF_C2H2 733 755 9.88e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204992
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Gm5581
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Gm5581 APN 6 131167641 unclassified noncoding transcript
IGL01372:Gm5581 APN 6 131168403 exon noncoding transcript
IGL01630:Gm5581 APN 6 131168296 exon noncoding transcript
IGL01667:Gm5581 APN 6 131167772 unclassified noncoding transcript
IGL02260:Gm5581 APN 6 131167946 unclassified noncoding transcript
IGL03212:Gm5581 APN 6 131181450 exon noncoding transcript
IGL03306:Gm5581 APN 6 131168081 unclassified noncoding transcript
R0366:Gm5581 UTSW 6 131166447 unclassified noncoding transcript
R1764:Gm5581 UTSW 6 131181399 exon noncoding transcript
R1961:Gm5581 UTSW 6 131168162 unclassified noncoding transcript
R2129:Gm5581 UTSW 6 131168284 exon noncoding transcript
R3177:Gm5581 UTSW 6 131166965 unclassified noncoding transcript
R4026:Gm5581 UTSW 6 131167068 unclassified noncoding transcript
R4943:Gm5581 UTSW 6 131167125 unclassified noncoding transcript
R4961:Gm5581 UTSW 6 131167227 unclassified noncoding transcript
R5817:Gm5581 UTSW 6 131167169 unclassified noncoding transcript
R5944:Gm5581 UTSW 6 131168400 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGAGGACTGGATAAATGATTTCCC -3'
(R):5'- CTCAGTGACAAGTTCTATGATGTAG -3'

Sequencing Primer
(F):5'- AGGTATCTCTTGGACTCTCC -3'
(R):5'- TCTATGAATGCAATGAATCATGGAAG -3'
Posted On2015-06-20