Incidental Mutation 'R4289:Kndc1'
ID322335
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139910882 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 433 (I433M)
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: I433M

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: I433M

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121839
AA Change: I433M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: I433M

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151421
AA Change: I433M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116435
Gene: ENSMUSG00000066129
AA Change: I433M

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAAAAGCAGACTGTGG -3'
(R):5'- GGAGCTCGTTTTAGGAACAGG -3'

Sequencing Primer
(F):5'- CAGACTGTGGCCAGAGCAG -3'
(R):5'- GTTTTAGGAACAGGAAGTCTCCCC -3'
Posted On2015-06-20