Incidental Mutation 'R4289:Ncam1'
ID322339
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49557172 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 329 (T329N)
Ref Sequence ENSEMBL: ENSMUSP00000141700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000192584] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect probably damaging
Transcript: ENSMUST00000114476
AA Change: T329N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: T329N

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166811
AA Change: T329N
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: T329N

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192584
AA Change: T329N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141700
Gene: ENSMUSG00000039542
AA Change: T329N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 1.2e-6 SMART
IGc2 130 196 2.6e-8 SMART
IGc2 226 295 2.6e-22 SMART
IGc2 321 393 1.6e-16 SMART
IGc2 418 487 4e-13 SMART
FN3 501 586 2.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193547
AA Change: T329N

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: T329N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194252
AA Change: T286N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCCATGTGCCAAAGG -3'
(R):5'- CAGTGTTGTCAGAATGCGTG -3'

Sequencing Primer
(F):5'- CCAAAGGGAACTGGGCATG -3'
(R):5'- GGAGTACAAGTCTGTGTCTCCTAC -3'
Posted On2015-06-20