Incidental Mutation 'R4289:Plxnb1'
ID322342
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109114352 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1888 (R1888W)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: R1888W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: R1888W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Meta Mutation Damage Score 0.43 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGAAGCTTTAGCCACTCC -3'
(R):5'- CCCAGTTAGGATGGAGACTTGG -3'

Sequencing Primer
(F):5'- AAGCTTTAGCCACTCCTGGGG -3'
(R):5'- GCATCAGCCAGTCTTAGACAG -3'
Posted On2015-06-20