Incidental Mutation 'R4300:Mboat2'
ID322387
Institutional Source Beutler Lab
Gene Symbol Mboat2
Ensembl Gene ENSMUSG00000020646
Gene Namemembrane bound O-acyltransferase domain containing 2
SynonymsOact2, 2810049G06Rik
MMRRC Submission 041657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4300 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24830879-24964397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24959083 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 463 (N463D)
Ref Sequence ENSEMBL: ENSMUSP00000152348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078902] [ENSMUST00000110942] [ENSMUST00000221952] [ENSMUST00000222994]
Predicted Effect probably benign
Transcript: ENSMUST00000078902
AA Change: N362D

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077937
Gene: ENSMUSG00000020646
AA Change: N362D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:MBOAT 97 405 8.9e-35 PFAM
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110942
AA Change: N495D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106567
Gene: ENSMUSG00000020646
AA Change: N495D

DomainStartEndE-ValueType
Pfam:MBOAT 21 430 2.8e-32 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221952
AA Change: N463D

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000222994
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,862 N513D probably benign Het
4930503B20Rik T A 3: 146,650,920 R78* probably null Het
A2m G A 6: 121,673,475 V1181I probably benign Het
Cacna1b T C 2: 24,635,239 S1639G probably damaging Het
Ccs T C 19: 4,834,257 T56A probably benign Het
Cd177 T C 7: 24,750,420 I547V possibly damaging Het
Ckmt2 C A 13: 91,863,338 probably null Het
Cyth1 A G 11: 118,183,894 F180L probably damaging Het
Dip2c A G 13: 9,610,711 I840M probably damaging Het
Gm37150 G A 9: 72,385,476 noncoding transcript Het
Herc1 A G 9: 66,489,406 D4255G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn4 G T 7: 24,377,604 V193L probably benign Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Mtfr1 T A 3: 19,215,457 probably null Het
Olfr192 T C 16: 59,098,278 Y238C unknown Het
Olfr981 A C 9: 40,023,139 I249L probably benign Het
Pcnt G C 10: 76,367,391 R2626G probably benign Het
Pik3cg A G 12: 32,176,672 I1072T probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psph G T 5: 129,787,465 probably null Het
Rfx4 T C 10: 84,905,102 Y601H probably damaging Het
Setd5 T G 6: 113,150,162 V1249G probably damaging Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Spata31 A T 13: 64,919,761 H79L probably benign Het
Srbd1 C A 17: 85,985,204 R979L probably damaging Het
Stox2 A T 8: 47,193,992 Y208* probably null Het
Sun1 A T 5: 139,227,594 probably benign Het
Tfap4 T C 16: 4,551,360 D132G probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tubgcp3 G T 8: 12,657,600 P130T probably damaging Het
Txlnb A G 10: 17,827,925 E277G probably damaging Het
Other mutations in Mboat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mboat2 APN 12 24939354 splice site probably benign
IGL00755:Mboat2 APN 12 24957646 missense probably benign 0.20
IGL01691:Mboat2 APN 12 24954222 missense probably damaging 1.00
IGL02824:Mboat2 APN 12 24946586 missense probably benign 0.03
R1052:Mboat2 UTSW 12 24946528 missense probably damaging 1.00
R1531:Mboat2 UTSW 12 24959030 missense probably benign
R1998:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R1999:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R2069:Mboat2 UTSW 12 24951443 missense probably benign
R2921:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R2923:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R3113:Mboat2 UTSW 12 24882719 missense probably damaging 1.00
R5133:Mboat2 UTSW 12 24959066 missense probably benign 0.00
R5356:Mboat2 UTSW 12 24957573 missense probably benign 0.24
R6084:Mboat2 UTSW 12 24878285 missense probably damaging 1.00
R6184:Mboat2 UTSW 12 24951431 missense possibly damaging 0.54
R6194:Mboat2 UTSW 12 24946638 missense probably benign 0.07
R6281:Mboat2 UTSW 12 24957679 missense probably benign 0.18
R7026:Mboat2 UTSW 12 24948382 critical splice donor site probably null
R7269:Mboat2 UTSW 12 24831709 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTGTTGCTGATAACCCTC -3'
(R):5'- TCCAATCTAGTGTATAGGAAACCCC -3'

Sequencing Primer
(F):5'- GTGTTGCTGATAACCCTCTTCCC -3'
(R):5'- TAGTGTATAGGAAACCCCCTATCCG -3'
Posted On2015-06-20