Incidental Mutation 'R0001:Kcnu1'
ID32243
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0001 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25859270 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 142 (D142V)
Ref Sequence ENSEMBL: ENSMUSP00000096457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858]
Predicted Effect probably damaging
Transcript: ENSMUST00000098858
AA Change: D142V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: D142V

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210273
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
PIT4677001:Kcnu1 UTSW 8 25905993 missense probably benign
R0419:Kcnu1 UTSW 8 25937618 missense probably benign 0.13
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0521:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2035:Kcnu1 UTSW 8 25896693 missense probably benign 0.35
R2082:Kcnu1 UTSW 8 25921549 missense probably damaging 1.00
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R2513:Kcnu1 UTSW 8 25905966 missense probably benign 0.00
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4184:Kcnu1 UTSW 8 25862417 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
R7202:Kcnu1 UTSW 8 25919581 splice site probably null
R7208:Kcnu1 UTSW 8 25919637 nonsense probably null
R7411:Kcnu1 UTSW 8 25892088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTGCATTGTCTACCCTGCCTTG -3'
(R):5'- AATTCTGGACCTGGTTTACACGCTC -3'

Sequencing Primer
(F):5'- GTCTACCCTGCCTTGATCTCTG -3'
(R):5'- AACTTGGAGCATAGGTCTTCTACC -3'
Posted On2013-05-09