Incidental Mutation 'R4301:Olfr1441'
ID322438
Institutional Source Beutler Lab
Gene Symbol Olfr1441
Ensembl Gene ENSMUSG00000050815
Gene Nameolfactory receptor 1441
SynonymsGA_x6K02T2RE5P-2753221-2754177, MOR215-2
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12417433-12423569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12422717 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 136 (L136P)
Ref Sequence ENSEMBL: ENSMUSP00000150739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059033] [ENSMUST00000214153] [ENSMUST00000216506]
Predicted Effect probably damaging
Transcript: ENSMUST00000059033
AA Change: L136P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061963
Gene: ENSMUSG00000050815
AA Change: L136P

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.7e-52 PFAM
Pfam:7tm_1 42 313 5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214153
AA Change: L136P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216506
AA Change: L136P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Olfr1441
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Olfr1441 APN 19 12422801 missense possibly damaging 0.91
IGL01653:Olfr1441 APN 19 12422372 missense probably benign
IGL01667:Olfr1441 APN 19 12422756 missense probably benign
IGL01903:Olfr1441 APN 19 12422683 missense probably benign 0.00
IGL02547:Olfr1441 APN 19 12422311 start codon destroyed probably benign 0.38
IGL02571:Olfr1441 APN 19 12422886 missense possibly damaging 0.79
IGL03310:Olfr1441 APN 19 12422927 missense probably benign
R0539:Olfr1441 UTSW 19 12422809 missense probably damaging 0.97
R0918:Olfr1441 UTSW 19 12423235 missense probably benign 0.25
R1463:Olfr1441 UTSW 19 12422888 missense probably benign 0.41
R4785:Olfr1441 UTSW 19 12422977 missense probably damaging 0.99
R5513:Olfr1441 UTSW 19 12422683 missense probably benign 0.00
R6188:Olfr1441 UTSW 19 12422610 missense probably benign 0.01
R6411:Olfr1441 UTSW 19 12422986 missense probably benign 0.08
R6625:Olfr1441 UTSW 19 12422841 missense probably damaging 1.00
R6944:Olfr1441 UTSW 19 12423264 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCCCCTAAGATGCTCTGTG -3'
(R):5'- AAGACAACCAGTGCTGATGCC -3'

Sequencing Primer
(F):5'- AGCCCCTAAGATGCTCTGTGATTTC -3'
(R):5'- CCAGGAAGTTCACTACTTGGCTG -3'
Posted On2015-06-20