Incidental Mutation 'R4302:Bcas1'
ID322446
Institutional Source Beutler Lab
Gene Symbol Bcas1
Ensembl Gene ENSMUSG00000013523
Gene Namebreast carcinoma amplified sequence 1
Synonyms9030223A09Rik, 2210416M21Rik, NABC1
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4302 (G1)
Quality Score215
Status Validated
Chromosome2
Chromosomal Location170346991-170427845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170418627 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 44 (V44A)
Ref Sequence ENSEMBL: ENSMUSP00000104780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013667] [ENSMUST00000068137] [ENSMUST00000109152]
Predicted Effect probably benign
Transcript: ENSMUST00000013667
AA Change: V44A

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000013667
Gene: ENSMUSG00000013523
AA Change: V44A

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 391 398 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068137
AA Change: V34A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069437
Gene: ENSMUSG00000013523
AA Change: V34A

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 335 342 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109152
AA Change: V44A

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104780
Gene: ENSMUSG00000013523
AA Change: V44A

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 312 N/A INTRINSIC
low complexity region 345 352 N/A INTRINSIC
low complexity region 496 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145920
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Bcas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Bcas1 APN 2 170349252 missense probably damaging 0.99
IGL01714:Bcas1 APN 2 170384182 splice site probably benign
IGL02267:Bcas1 APN 2 170378788 nonsense probably null
IGL02486:Bcas1 APN 2 170406398 missense probably damaging 1.00
IGL03328:Bcas1 APN 2 170366396 nonsense probably null
R0335:Bcas1 UTSW 2 170418681 missense probably damaging 0.97
R1458:Bcas1 UTSW 2 170387951 missense probably damaging 1.00
R1463:Bcas1 UTSW 2 170418664 missense probably benign 0.07
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1507:Bcas1 UTSW 2 170366428 missense probably damaging 0.99
R1645:Bcas1 UTSW 2 170387167 missense probably damaging 1.00
R1654:Bcas1 UTSW 2 170349246 missense probably damaging 1.00
R1911:Bcas1 UTSW 2 170387943 missense probably damaging 1.00
R1990:Bcas1 UTSW 2 170370477 missense possibly damaging 0.83
R2017:Bcas1 UTSW 2 170348161 splice site probably null
R4119:Bcas1 UTSW 2 170378815 missense probably benign 0.02
R4181:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4497:Bcas1 UTSW 2 170406821 missense probably damaging 1.00
R4670:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4671:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4914:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4915:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4917:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4918:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R5155:Bcas1 UTSW 2 170418618 missense probably damaging 0.98
R5354:Bcas1 UTSW 2 170349396 missense possibly damaging 0.94
R5686:Bcas1 UTSW 2 170406810 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCAGCGTATAAGCACCCAG -3'
(R):5'- AGAGAGTCATTTTGCTACCGGAAG -3'

Sequencing Primer
(F):5'- CGTATAAGCACCCAGTGTGG -3'
(R):5'- GGAAGCTGGCAGTTTCTATAAACAC -3'
Posted On2015-06-20