Incidental Mutation 'R4302:Wdr66'
ID322450
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4302 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123293810 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 549 (I549T)
Ref Sequence ENSEMBL: ENSMUSP00000129769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069311] [ENSMUST00000121964] [ENSMUST00000163092] [ENSMUST00000170536]
Predicted Effect probably benign
Transcript: ENSMUST00000069311
SMART Domains Protein: ENSMUSP00000069782
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
Blast:WD40 54 95 3e-24 BLAST
SCOP:d1exra_ 157 267 3e-4 SMART
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121964
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143629
Predicted Effect unknown
Transcript: ENSMUST00000150155
AA Change: I26T
Predicted Effect probably benign
Transcript: ENSMUST00000163092
SMART Domains Protein: ENSMUSP00000126995
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
Blast:WD40 1 28 3e-10 BLAST
Blast:WD40 35 75 2e-15 BLAST
Blast:WD40 87 126 3e-17 BLAST
low complexity region 130 144 N/A INTRINSIC
WD40 146 180 7.64e1 SMART
Blast:WD40 183 246 2e-14 BLAST
WD40 248 287 8.62e-4 SMART
WD40 292 330 1.19e1 SMART
WD40 335 374 5.97e-1 SMART
WD40 383 426 1.23e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170536
AA Change: I549T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129769
Gene: ENSMUSG00000029442
AA Change: I549T

DomainStartEndE-ValueType
WD40 42 86 3.18e1 SMART
Blast:WD40 93 133 1e-15 BLAST
Blast:WD40 145 184 3e-17 BLAST
low complexity region 188 202 N/A INTRINSIC
WD40 204 238 7.64e1 SMART
Blast:WD40 241 304 3e-14 BLAST
WD40 306 345 8.62e-4 SMART
WD40 350 388 1.19e1 SMART
WD40 393 432 5.97e-1 SMART
WD40 441 484 1.23e2 SMART
Blast:WD40 490 535 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197763
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGGCAGCTCAATCCACTCG -3'
(R):5'- CAAGGCGCTGGGAACTGAT -3'

Sequencing Primer
(F):5'- CCAACAGTCCAGTTTGGTAGCAG -3'
(R):5'- GCCAACTCGTGAAGGAACGTTTC -3'
Posted On2015-06-20